Academic Journal
View in EDS
PDF Full Text
HTML Full Text

Association between oncogenic human papillomavirus type 16 and Killian polyp

Bibliographic Details
Title: Association between oncogenic human papillomavirus type 16 and Killian polyp
Authors: Lucia Oton-Gonzalez, John Charles Rotondo, Luca Cerritelli, Nicola Malagutti, Carmen Lanzillotti, Ilaria Bononi, Andrea Ciorba, Chiara Bianchini, Chiara Mazziotta, Monica De Mattei, Stefano Pelucchi, Mauro Tognon, Fernanda Martini
Source: Infectious Agents and Cancer, Vol 16, Iss 1, Pp 1-9 (2021)
Publisher Information: BMC, 2021.
Publication Year: 2021
Collection: LCC:Neoplasms. Tumors. Oncology. Including cancer and carcinogens
LCC:Infectious and parasitic diseases
Subject Terms: Killian polyp, Human papillomavirus, Polyomavirus, Infection, Nasal polyps, Neoplasms. Tumors. Oncology. Including cancer and carcinogens, RC254-282, Infectious and parasitic diseases, RC109-216
More Details: Abstract Background Killian polyp (KP) is a benign lesion that arises from the maxillary sinus. The etiology of KP is unknown. The aim of this study was to investigate the potential involvement of human papilloma- (HPV) and polyoma-viruses (HPyV) infections in the onset of KP. Methods DNA from antral (n = 14) and nasal (n = 14) KP fractions were analyzed for HPV and HPyV sequences, genotypes, viral DNA load and physical status along with expression of viral proteins and p16 cellular protein. Results The oncogenic HPV16 was detected in 3/14 (21.4%) antral KPs, whilst nasal KPs tested HPV-negative (0/14). The mean HPV16 DNA load was 4.65 ± 2.64 copy/104 cell. The whole HPV16 episomal genome was detected in one KP sample, whereas HPV16 DNA integration in two KPs. P16 mRNA level was lower in the KP sample carrying HPV16 episome than in KPs carrying integrated HPV16 and HPV- negative KPs (p
Document Type: article
File Description: electronic resource
Language: English
ISSN: 1750-9378
Relation: https://doaj.org/toc/1750-9378
DOI: 10.1186/s13027-020-00342-3
Access URL: https://doaj.org/article/d550ee448cf644c49aefe8ea20ffdcc5
Accession Number: edsdoj.550ee448cf644c49aefe8ea20ffdcc5
Database: Directory of Open Access Journals
Full text is not displayed to guests.
FullText Links:
  – Type: pdflink
    Url: https://content.ebscohost.com/cds/retrieve?content=AQICAHjPtM4BHU3ZchRwgzYmadcigk49r9CVlbU7V5F6lgH7WwGRy39bCU9erAMovA8r9y_8AAAA4jCB3wYJKoZIhvcNAQcGoIHRMIHOAgEAMIHIBgkqhkiG9w0BBwEwHgYJYIZIAWUDBAEuMBEEDJeDAdEaCwpUlahWzwIBEICBmgoIQmxWuU1qvbK_MyAenwVzAc6IeGdEc-L94U5BrcQ4jEKHdvg-DYRrYyGJP5DEi_qcf8tIGdE7ShdIU-VV1gTDRK_Ka4ihg54btwwet2cMBrjUlAd0wsgXbXk_SAglkskHtaoD63u2yDFfoWI6FwtaLFaj8jCMnU1__kig4yJ4-5_skdjSqCXHxuX2JY0HDnv_aNX83mlOi8M=
Text:
  Availability: 1
  Value: <anid>AN0147997086;[38mo]07jan.21;2021Jan11.05:49;v2.2.500</anid> <title id="AN0147997086-1">Association between oncogenic human papillomavirus type 16 and Killian polyp </title> <p>Background: Killian polyp (KP) is a benign lesion that arises from the maxillary sinus. The etiology of KP is unknown. The aim of this study was to investigate the potential involvement of human papilloma- (HPV) and polyoma-viruses (HPyV) infections in the onset of KP. Methods: DNA from antral (n = 14) and nasal (n = 14) KP fractions were analyzed for HPV and HPyV sequences, genotypes, viral DNA load and physical status along with expression of viral proteins and p16 cellular protein. Results: The oncogenic HPV16 was detected in 3/14 (21.4%) antral KPs, whilst nasal KPs tested HPV-negative (0/14). The mean HPV16 DNA load was 4.65 ± 2.64 copy/10<sup>4</sup> cell. The whole HPV16 episomal genome was detected in one KP sample, whereas HPV16 DNA integration in two KPs. P16 mRNA level was lower in the KP sample carrying HPV16 episome than in KPs carrying integrated HPV16 and HPV- negative KPs (p< 0.001). None of the antral and nasal KP samples tested positive for HPyV DNA (0/28). Conclusions: A fraction of KP tested positive for the oncogenic HPV16. HPV16 detection in the KP antral portion may be consistent with HPV16 infection derived from the maxillary sinus. HPV16 DNA integration represents a novel finding. Altogether, these data improve our knowledge on the association between KP and HPV infection, whereas it indicates that the KP onset is heterogeneous.</p> <p>Keywords: Killian polyp; Human papillomavirus; Polyomavirus; Infection; Nasal polyps</p> <p>Lucia Oton-Gonzalez and John Charles Rotondo contributed equally to this work.</p> <hd id="AN0147997086-2">Introduction</hd> <p>Killian polyp (KP), or antrochoanal polyp, is a benign lesion of the upper respiratory tract arising from the maxillary anthrum, which may extend through the nasal cavity to the choana. KP represents about 5 and 33% of nasal polyps in adults and children, respectively [[<reflink idref="bib1" id="ref1">1</reflink>]]. KP usually presents as unilateral pedunculated mass composed by an antral portion, which is usually cystic, and a nasal/choanal fraction, emerging through an enlarged maxillary accessory ostium [[<reflink idref="bib3" id="ref2">3</reflink>]].</p> <p>The etiopathogenesis of KP is not known. Several studies have suggested that autoreactivity, allergies and/or chronic inflammation could be risk factors for KP onset [[<reflink idref="bib4" id="ref3">4</reflink>]–[<reflink idref="bib6" id="ref4">6</reflink>]]. KPs are indeed inflammatory polyps [[<reflink idref="bib7" id="ref5">7</reflink>]]. Schryver et al. questioned if autoreactivity contributed to the KP onset or it resulted from a chronic inflammation, and proposed to investigate other inflammation causes, such as viral infections [[<reflink idref="bib8" id="ref6">8</reflink>]]. In fact, KP recurrence after its incomplete surgical removal suggests that viral infections may play a role [[<reflink idref="bib3" id="ref7">3</reflink>], [<reflink idref="bib9" id="ref8">9</reflink>]].</p> <p>Different viruses are able to infect the oropharyngeal region, and play a role in various head and neck diseases [[<reflink idref="bib11" id="ref9">11</reflink>]]. Specifically, human papillomaviruses (HPV) and polyomaviruses (HPyV) such as BKPyV, JCPyV and Merkel cell polyomavirus (MCPyV), are DNA viruses infecting the tonsillar tissues [[<reflink idref="bib13" id="ref10">13</reflink>]–[<reflink idref="bib16" id="ref11">16</reflink>]], and have been associated to the development of respiratory diseases as well as to head and neck cancer [[<reflink idref="bib17" id="ref12">17</reflink>]–[<reflink idref="bib20" id="ref13">20</reflink>]]. HPV and HPyV display similar biological behavior in infected target tissues. After infection of epithelial cells, HPV and HPyV may multiply and spread in different anatomical sites, or enter lifelong latent phase, whereby viral DNA is maintained at low copy number [[<reflink idref="bib21" id="ref14">21</reflink>]]. In some instance, long term latency of the oncogenic HPV and HPyV types may result in viral DNA integration into the host cell genome, leading to cell transformation upon viral oncoprotein overexpression [[<reflink idref="bib21" id="ref15">21</reflink>]–[<reflink idref="bib25" id="ref16">25</reflink>]].</p> <p>The association between HPV infection and KP has been poorly investigated, whereas studies on HPyV in KP are missing. HPV sequences have been found at different prevalence, ranging 0–54% [[<reflink idref="bib26" id="ref17">26</reflink>]–[<reflink idref="bib28" id="ref18">28</reflink>]]. Moreover, oncogenic HPV genotypes such as HPV16, have been found to be prevalent in KPs, raising the question if HPV may play role in cell transformation. One recent study focusing on tumor marker expression, such as p16 and viral oncoproteins, did not find any correlation between HPV DNA positivity and KP development, concluding that HPV latently infects KP [[<reflink idref="bib27" id="ref19">27</reflink>]]. However, HPV DNA load and physical status, which are two main hallmarks of latent or active infection, have not been assessed yet in KP [[<reflink idref="bib29" id="ref20">29</reflink>]].</p> <p>Even though maxillary sinus viral infections are considered risk factors for KP, there is no evidence proving the KP etiopathogenesis from this infection. So far, studies focusing on the identification of viral infections have analyzed bulk KP tissues without diversifying between the antral and nasal components. This distinction would be particularly important to understand if viral infections may play a role in the KP onset. In fact, any viral sequences detected in the antral region might account for maxillary sinus infections, and therefore potentially involved in the onset of KP, while those in the nasal region might be due to nasopharyngeal infections after the KP formation, thus not relevant for KP onset.</p> <p>The aim of this study was to investigate the potential involvement of HPV and HPyV infections in the onset of KP. To this purpose, tissue samples from KP were divided into antral and nasal parts, and analyzed separately for HPVs and HPyVs sequences, genotypes, DNA load and physical status (episomal vs integrated), and expression, along with expression levels of p16, which is a cell protein strictly associated to active HPV infection.</p> <hd id="AN0147997086-3">Materials and methods</hd> <p></p> <hd id="AN0147997086-4">Samples</hd> <p>Killian polyp (KP) tissue specimens were collected from 14 patients (Mean age ± SD; 44 ± 18 years) who underwent surgical removal at the Ear, Nose and Throat Unit, University Hospital of Ferrara (Italy). Inclusion criteria were unilateral polyp with histopathological diagnosis of KP and age between 18 and 80 yrs. Exclusion criteria were bilateral polyps not coincident with KP. Written informed consent was obtained from all patients. The study was conducted in accordance with the Declaration of Helsinki. The protocol was approved by the County Ethical Committee (ID:160986).</p> <hd id="AN0147997086-5">Nucleic acids extraction</hd> <p>KP tissue samples (<emph>n</emph>=14) were divided into two portions: the antral (<emph>n</emph>=14) and the nasal portion (<emph>n</emph>=14). Samples (<emph>n</emph>=28) were incubated overnight with proteinase K at 56 °C to allow tissue digestion. Then, nucleic acids were simultaneously extracted from samples using the All Prep DNA/RNA extraction kit (Qiagen, Milan, Italy). DNA from KPs was isolated/purified together with a salmon sperm DNA (ssDNA) sample and a mock sample lacking DNA [[<reflink idref="bib30" id="ref21">30</reflink>]]. After purification, DNAs/RNAs were quantified spectrophotometrically (NanoDrop 2000, Thermo Scientific) [[<reflink idref="bib31" id="ref22">31</reflink>]]. DNA amplification suitability was evaluated by <emph>β-globin</emph> gene PCR [[<reflink idref="bib32" id="ref23">32</reflink>]]. DNA/RNAs were stored at − 80 °C until time of analysis.</p> <hd id="AN0147997086-6">Detection of HPV and HPyV DNAs</hd> <p>KP tissue samples were tested for HPV and BKPyV, JCPyV and MCPyV DNA sequences, by quantitative PCR (qPCR). Fifty ng of human genomic DNA were used in 10 μl qPCR reactions. For HPV DNA detection the universal primers GP5+/GP6+ (Table 1) were used, as previously reported [[<reflink idref="bib33" id="ref24">33</reflink>]]. These primers allow simultaneous amplification of several HPV types [[<reflink idref="bib35" id="ref25">35</reflink>]], including those frequently detected in KP, such as HPV6/11/16/18 [[<reflink idref="bib27" id="ref26">27</reflink>]]. QPCR reactions included 2x of the SsoAdvanced Universal SYBR Green Supermix, Bio-Rad (Hercules, CA, USA) and a final concentration of 0.5 μM for each GP5+/GP6+ primer. For HPyV DNA detection, specific primers for BKPyV, JCPyV and MCPyV were employed [[<reflink idref="bib25" id="ref27">25</reflink>], [<reflink idref="bib38" id="ref28">38</reflink>]]. QPCR reactions included 2x of the TaqMan Universal Master Mix II, no UNG, Thermo Fisher Scientific (Waltham, MA, USA), and 1X of primers and probe assays (Table 1). Recombinant plasmids containing HPV16 genome and BKPyV, JCPyV, and MCPyV genomes were used as positive controls [[<reflink idref="bib25" id="ref29">25</reflink>], [<reflink idref="bib38" id="ref30">38</reflink>]], whereas ssDNA and mock samples lacking of DNA, as negative controls of DNA extraction and PCR amplification. Each assay was run in triplicate.</p> <p>Table 1 Primers used in qPCR to detect and quantify HPV, PyV DNA, viral, cellular genes</p> <p> <ephtml> <table frame="hsides" rules="groups"><thead><tr><th /><th><p>Target</p></th><th><p>Primers names</p></th><th><p>Primers sequence (5′→ 3′)</p></th><th><p>Amplicon size (bp)</p></th><th><p>Annealing temp. (°C)</p></th><th><p>References</p></th></tr></thead><tbody><tr><td colspan="7"><p><bold>DNA</bold></p></td></tr><tr><td rowspan="13"><p> Viral</p></td><td><p>HPV L1</p></td><td><p>GP5+</p></td><td><p>TTTGTTACTGTGGTAGATACTAC</p></td><td><p>139–145</p></td><td><p>48</p></td><td><p>Malagutti et al. 2020 [<xref ref-type="bibr" rid="bibr33">33</xref>]; Tognon et al. 2020 [<xref ref-type="bibr" rid="bibr34">34</xref>]; Rotondo et al. 2020a [<xref ref-type="bibr" rid="bibr35">35</xref>]</p></td></tr><tr><td /><td><p>GP6+</p></td><td><p>GAAAAATAAACTGTAAATCATATTC</p></td><td /><td /><td /></tr><tr><td><p>HPV16 E2</p></td><td><p>E- HPV16 E2 F</p></td><td><p>AACGAAGTATCCTCTCCTGAAATTATTAG</p></td><td><p>82</p></td><td><p>60</p></td><td><p>Peitsaro, Johansson, e Syrjänen 2002 [<xref ref-type="bibr" rid="bibr37">37</xref>]</p></td></tr><tr><td /><td><p>E- HPV16 E2 R</p></td><td><p>CCAAGGCGACGGCTTTG</p></td><td /><td /><td /></tr><tr><td /><td><p>E Probe 16E2PRO</p></td><td><p>[ROX] CACCCCGCCGCGACCCATA [BHQ2]</p></td><td /><td /><td /></tr><tr><td><p>HPV16 E6</p></td><td><p>I+E- HPV16 E6 F</p></td><td><p>GAGAACTGCAATGTTTCAGGACC</p></td><td><p>81</p></td><td><p>60</p></td><td /></tr><tr><td /><td><p>I+E- HPV16 E6 R</p></td><td><p>TGTATAGTTGTTTGCAGCTCTGTGC</p></td><td /><td /><td /></tr><tr><td /><td><p>I+E Probe 16E6PRO</p></td><td><p>[6FAM] CAGGAGCGACCCAGAAAGTTACCACAGTT [BHQ1]</p></td><td /><td /><td /></tr><tr><td><p>MCPyV</p></td><td><p>RQ MCPyV_LT.1F</p></td><td><p>CCACAGCCAGAGCTCTTCCT</p></td><td /><td /><td><p>Tagliapietra et al. 2020 [<xref ref-type="bibr" rid="bibr38">38</xref>]</p></td></tr><tr><td /><td><p>RQ MCPyV_LT.1R</p></td><td><p>TGGTGGTCTCCTCTCTGCTACTG</p></td><td /><td /><td /></tr><tr><td /><td><p>RQ MCPyV_LT Probe</p></td><td><p>[6FAM] TCCTTCTCAGCGTCCCAGGCTTCA [MGB]</p></td><td /><td /><td /></tr><tr><td><p>JCPyV</p></td><td><p>Assay_JCyV</p></td><td><p>AI1RWNE</p></td><td /><td /><td><p>Tagliapietra et al. 2019 [<xref ref-type="bibr" rid="bibr39">39</xref>]</p></td></tr><tr><td><p>BKPyV</p></td><td><p>Assay_BKyV</p></td><td><p>AI20UTM</p></td><td /><td /><td /></tr><tr><td rowspan="2"><p> Host</p></td><td><p>β-Globin</p></td><td><p>β-Globin F</p></td><td><p>TGGGTTTCTGATAGGCACTGACT</p></td><td><p>152</p></td><td><p>56</p></td><td><p>Contini et al. 2018 [<xref ref-type="bibr" rid="bibr32">32</xref>]</p></td></tr><tr><td /><td><p>β-Globin R</p></td><td><p>AACAGCATCAGGAGTGGACAGAT</p></td><td /><td /><td /></tr><tr><td colspan="7"><p><bold>RNA</bold></p></td></tr><tr><td rowspan="8"><p> Viral</p></td><td><p>HPV16 E2</p></td><td><p>HPV16 E2 F</p></td><td><p>AACGAAGTATCCTCTCCTGAAATTATTAG</p></td><td><p>82</p></td><td><p>60</p></td><td><p>Peitsaro, Johansson, e Syrjänen 2002 [<xref ref-type="bibr" rid="bibr37">37</xref>]</p></td></tr><tr><td /><td><p>HPV16 E2 R</p></td><td><p>CCAAGGCGACGGCTTTG</p></td><td /><td /><td /></tr><tr><td><p>HPV16 E6</p></td><td><p>HPV16 E6 F</p></td><td><p>GAGAACTGCAATGTTTCAGGACC</p></td><td><p>81</p></td><td><p>60</p></td><td /></tr><tr><td /><td><p>HPV16 E6 R</p></td><td><p>TGTATAGTTGTTTGCAGCTCTGTGC</p></td><td /><td /><td /></tr><tr><td><p>HPV16 E5</p></td><td><p>16-E5 FWD</p></td><td><p>CGTCCGCTGCTTTTGTCTGTGTCTACATAC</p></td><td><p>89</p></td><td><p>60</p></td><td><p>Weyn et al. 2011 [<xref ref-type="bibr" rid="bibr40">40</xref>]</p></td></tr><tr><td /><td><p>16-E5 REV</p></td><td><p>CACCTAAACGCAGAGGCTGCTGTTATCCAC</p></td><td /><td /><td /></tr><tr><td><p>HPV16 E7</p></td><td><p>E7 FWD</p></td><td><p>AGGAGGATGAAATAGATGGTCCAG</p></td><td><p>112</p></td><td><p>60</p></td><td><p>Pett et al. 2006 [<xref ref-type="bibr" rid="bibr41">41</xref>]</p></td></tr><tr><td /><td><p>E7 REV</p></td><td><p>CTTTGTACGCACAACCGAAGC</p></td><td /><td /><td /></tr><tr><td rowspan="4"><p> Host</p></td><td><p>P16INK4A</p></td><td><p>p16 ink4a FWD</p></td><td><p>CCAACGCACCGAATAGTTACG</p></td><td><p>58</p></td><td><p>60</p></td><td><p>Marcoux et al. 2013 [<xref ref-type="bibr" rid="bibr42">42</xref>]</p></td></tr><tr><td /><td><p>p16 ink4a REV</p></td><td><p>GCGCTGCCCATCATCATG</p></td><td /><td /><td /></tr><tr><td><p>GAPDH</p></td><td><p>GAPDH F</p></td><td><p>GAAGGTGAAGGTCGGAGTC</p></td><td><p>226</p></td><td><p>60</p></td><td><p>Xiao et al. 2011 [<xref ref-type="bibr" rid="bibr43">43</xref>]</p></td></tr><tr><td /><td><p>GAPDH R</p></td><td><p>GAAGATGGTGATGGGATTTC</p></td><td /><td /><td /></tr></tbody></table> </ephtml> </p> <hd id="AN0147997086-7">HPV DNA load, genotype and physical status analyses</hd> <p>HPV DNA load was quantified by qPCR assay using the GP5+/GP6+ primers and a 10-fold dilutions standard curve, from 10<sups>8</sups> to 10<sups>2</sups> copies, of recombinant plasmids. HPV DNA load values were reported as viral copies per human cell equivalents (viral copy/cell). Samples were normalized vs. HPV16-positive SiHa cell line, which contains one HPV16 copy/cell. Human <emph>β-globin</emph> gene was used to determine the human cell equivalents of each sample [[<reflink idref="bib32" id="ref31">32</reflink>]]. HPV genotype was determined by differential melting temperature (T<subs>m</subs>), adding a high resolution melting (HRM) step, from 65 °C to 95 °C (ramping 0.1 °C every 0.03 s), to the qPCR analysis, as done before for detection of the HPV16 and HPV18 genotypes [[<reflink idref="bib44" id="ref32">44</reflink>]]. HPV6/11/16/18 plasmids were used as positive controls. HPV DNA physical status was investigated using the E2/E6 ratio by qPCR, as previously described (Table 1) [[<reflink idref="bib37" id="ref33">37</reflink>]]. Briefly, 50 ng of template DNA were analyzed in 10 μl multiplex PCR reactions, 2x TaqMan Universal Master Mix II, no UNG, Thermo Fisher Scientific (Waltham, MA, USA); 0.3 μM of each HPV16 E2 primer; 0.5 μM of each HPV16 E6 primer; and 0.1 μM of each E2 and E6 probe. E2/E6 ratio equal to 1 indicated episomal form, less or more than 1 mixed forms, i.e. episomal and integrated, whereas no E2 DNA detection indicated full integration. Each assay was run in triplicate.</p> <hd id="AN0147997086-8">Rolling circle amplification (RCA) assay</hd> <p>The episomal viral DNAs were detected by rolling circle amplification (RCA) assay using the TempliPhi™ 100 Amplification Kit (GE Healthcare, Chicago, USA) [[<reflink idref="bib45" id="ref34">45</reflink>]], and in accordance with manufacturer's instructions. Briefly, reactions were prepared with 25 ng of genomic DNA and 175 μM of dNTP mix (Thermo Scientific, Massachusetts, USA). The specificity of the RCA products was assessed by DNA restriction enzyme digestion in a final volume of 10 μL (Thermo Scientific, Massachusetts, USA). RCA and digested RCA products were visualized onto a 0.8% agarose gel. Positive and negative controls were used in the RCA assay.</p> <hd id="AN0147997086-9">Gene expression analysis</hd> <p>Total RNA was retrotranscribed using the Improm II (Promega, Wisconsin, USA) reverse transcription system [[<reflink idref="bib46" id="ref35">46</reflink>]]. cDNAs were analyzed for the expression of HPV16 <emph>E2</emph>, <emph>E6</emph>, <emph>E7</emph> and <emph>E5</emph> genes and <emph>p16</emph> cellular gene (Table 1) [[<reflink idref="bib37" id="ref36">37</reflink>], [<reflink idref="bib40" id="ref37">40</reflink>]–[<reflink idref="bib42" id="ref38">42</reflink>]]. Briefly, 50 ng of cDNA were used in 10 μl reaction, 2x of the SsoAdvanced Universal SYBR Green Supermix, Bio-Rad (Hercules, CA, USA) and a final concentration of 0.5 μM for each primer [[<reflink idref="bib47" id="ref39">47</reflink>]]. <emph>GAPDH</emph> gene was employed as control for the gene expression analysis [[<reflink idref="bib43" id="ref40">43</reflink>]]. SiHa cell line was used as positive control for HPV gene expression and mock sample as negative control. Each assay was run in triplicate.</p> <hd id="AN0147997086-10">Statistical analyses</hd> <p>Statistical analyses were performed using the GraphPad Prism for Windows (version 6.0, GraphPad, California, USA) [[<reflink idref="bib48" id="ref41">48</reflink>]]. For mRNA, fold change was calculated by the 2<sups>-ΔΔCt</sups> method and represented in Log<subs>2</subs> scale, using HPV-negative samples as controls [[<reflink idref="bib31" id="ref42">31</reflink>]]. One-way analysis of variance was used to compare fold-change among samples [[<reflink idref="bib50" id="ref43">50</reflink>]]. <emph>P</emph> values less than 0.05 were considered statistically significant (<emph>p</emph>< 0.05) [[<reflink idref="bib51" id="ref44">51</reflink>]].</p> <hd id="AN0147997086-11">Results</hd> <p></p> <hd id="AN0147997086-12">Prevalence of HPV and HPyV sequences</hd> <p>DNAs isolated from KP tissue samples (<emph>n</emph>=28) represented by antral (<emph>n</emph>=14) and nasal (<emph>n</emph>=14) portions were tested for viral DNA sequences of HPV and HPyVs. The qPCR analyses showed that 3/14 (21.4%) of the antral KP tissues were positive for HPV DNA (Table 2). None of the nasal KP samples (<emph>n</emph>=14) tested positive for HPV DNA (0/14; 0%) (Table 2). KP tissue samples analyzed for BKPyV, JCPyV and MCPyV DNA sequences gave negative results in both antral (<emph>n</emph>=14) and nasal (<emph>n</emph>=14) portions (0/14; 0%) (Table 2).</p> <p>Table 2 Prevalence of HPV and HPyV in antral and nasal KP tissues</p> <p> <ephtml> <table frame="hsides" rules="groups"><thead><tr><th><p>Tissue sample</p></th><th colspan="4"><p>Number of positive samples/samples analyzed (%)</p></th></tr><tr><th /><th><p>HPV</p></th><th><p>MCPyV</p></th><th><p>JCPyV</p></th><th><p>BKPyV</p></th></tr></thead><tbody><tr><td><p><bold>Antral KP</bold></p></td><td><p>3/14 (21.4)</p></td><td><p>0/14 (0)</p></td><td><p>0/14 (0)</p></td><td><p>0/14 (0)</p></td></tr><tr><td><p><bold>Nasal KP</bold></p></td><td><p>0/14 (0)</p></td><td><p>0/14 (0)</p></td><td><p>0/14 (0)</p></td><td><p>0/14 (0)</p></td></tr></tbody></table> </ephtml> </p> <hd id="AN0147997086-13">HPV DNA load, genotyping, and physical status analyses</hd> <p>HPV DNA load was determined by comparison to the HPV plasmid standard curve in qPCR assay. The mean viral DNA load in HPV-positive antral KPs (<emph>n</emph>=3) was 4.65±2.64 copy/10<sups>4</sups> cell. In detail, in the three HPV-positive antral KP samples, the viral DNA load was 8.32 copy/10<sups>4</sups> cell, 3.43 copy/10<sups>4</sups> cell, and 2.21 copy/10<sups>4</sups> cell. HPV genotype analyses were carried out by HRM qPCR assay. Firstly, the optimal T<subs>m</subs> range for discriminating HPV6/11/16/18 types from GP5+/GP6+ amplicons was identified, which was between 75.4–79.5±0.2 °C (Fig. 1a). HPV genotype analyses were carried out by comparing qPCR T<subs>m</subs> with the positive controls. Results indicated that the three HPV-positive antral KP samples carried the HPV type 16 (3/3; 100%) (Fig. 1b).</p> <p>Graph: Fig. 1 HPV differential melt peaks. a Melting temperature (Tm) for; 1) pUC19_HPV16; 2) pUC19_HPV11; 3) pUC19_HPV6 and 4) pUC19_HPV18. b Tm for KP samples, corresponding to that of pUC19_HPV16</p> <p>HPV16 DNA physical status was assessed by E2/E6 ratio in the three HPV16-positive antral KP samples. The E2/E6 ratio was 1.01 in one sample (1/3; 33.3%) indicating presence of HPV16 in the episomal form. In the two other samples only the E6 sequence was found (2/3; 66.6%), indicating that HPV16 was integrated into the host cell genome.</p> <hd id="AN0147997086-14">HPV physical status validation by RCA</hd> <p>Antral KP DNAs (<emph>n</emph>=14) were investigated by RCA for validating the HPV DNA episomal physical status. Successfully amplification was obtained only in the KP sample detected with E2/E6 ratio of 1.01, that was predictable of the episomal form. The molecular weight for the positive band corresponding to approximately 8000 bp was consistent of the HPV genome (Fig. 2, lane S2). Digestion with Bam HI enzyme, which cuts once into HPV16 genome, further confirmed the positivity for HPV16.</p> <p>Graph: Fig. 2 Rolling circle amplification assay performed on antral KP DNAs. MW: Molecular Weight. Negative controls: H2O, Salmon Sperm DNA (SS), Neg digestion (H2O). KP DNAs 1–14</p> <hd id="AN0147997086-15">Gene expression analysis</hd> <p>Viral gene expression was studied for the HPV-positive antral KP samples (<emph>n</emph>=3). No expression for HPV16 <emph>E2</emph>, <emph>E5</emph>, <emph>E6</emph>, <emph>E7</emph> genes was detectable in any of the samples analyzed, indicating either that HPV16 is not transcriptionally active in KP or that viral mRNA levels were too low to be detected under qPCR conditions. To gain insight into this topic, p16, which is considered a surrogate marker of active HPV infection, was analyzed for mRNA expression in the three antral HPV-positive KP samples, containing the episomal HPV16 (<emph>n</emph>=1) and the integrated HPV16 (<emph>n</emph>=2). Results indicated that <emph>p16</emph> mRNA level was 8.01-fold lower in HPV16-episome KP sample than in HPV16-integrated KP samples and 7.05-fold lower in HPV16-episome KP sample than in HPV-negative samples (<emph>p</emph>< 0.0001, Fig. 3). Although not statistically significant, <emph>p16</emph> expression was slightly higher in HPV16-integrated KP samples compared to HPV-negative samples (<emph>p</emph>> 0.05, Fig. 3).</p> <p>Graph: Fig. 3 p16 mRNA expression. KPs (n=14) were stratified according to HPV positivity/negativity. HPV-positive were further divided in episomal (n=1) and integrated (n=2). ****p< 0.0001</p> <hd id="AN0147997086-16">Discussion</hd> <p>The etiopathogenesis of KP is still not completely understood. Viral infections have been suggested to be involved in KP onset [[<reflink idref="bib52" id="ref45">52</reflink>]]. Herein, with the aim to verify the putative role of the viral infections, HPV and HPyV were investigated in KP samples. Independent analyses of the antral and nasal region were useful in understanding whether the KP infections depended on the maxillary sinus or the nasal cavity.</p> <p>HPV sequences were detected in 21% of the antral KP samples, while none of the nasal samples tested positive for HPV. This result indicates that the KP antral region is target of HPV infection and suggests a possible link between maxillary sinus infections and KP development. In term of prevalence, our data are in agreement with previous studies reporting HPV rates ranging from 0 to 54% in KP samples, although the new methodological approach used herein does not allow our and previous data to be compared adequately [[<reflink idref="bib26" id="ref46">26</reflink>], [<reflink idref="bib54" id="ref47">54</reflink>]–[<reflink idref="bib60" id="ref48">60</reflink>]].</p> <p>HPV genotypes have been investigated in two previous studies reporting HPV16 to be frequently detected at higher rate, 61.9 and 85.72%, respectively, than HPV11, 14.3 and 14.28%, respectively [[<reflink idref="bib27" id="ref49">27</reflink>]]. In this study HPV16 was the only viral genotype detected in KP. These results are of interest as HPV16 is the high risk oncogenic type involved in development of different tumors [[<reflink idref="bib24" id="ref50">24</reflink>], [<reflink idref="bib61" id="ref51">61</reflink>]–[<reflink idref="bib63" id="ref52">63</reflink>]], including head and neck cancer [[<reflink idref="bib64" id="ref53">64</reflink>]].</p> <p>HPV viral load and physical status are indicative of active or latent infection in the infected tissues [[<reflink idref="bib29" id="ref54">29</reflink>], [<reflink idref="bib66" id="ref55">66</reflink>]]. For the first time, DNA load and physical status was investigated in HPV-positive KP samples. The viral DNA load was lower than 1 copy/cell, which is consistent with latent or persistent infection occurring in normal tissues [[<reflink idref="bib67" id="ref56">67</reflink>]]. When HPV physical status was analyzed a heterogeneous trend was found among the HPV-positive KP samples. One sample carried HPV16 in episomal form, which was confirmed amplifying the whole HPV genome by RCA assay. Instead, two KP samples showed the HPV16 DNA in integrated form. This is an interesting finding because high risk HPV integration into the host cell genome is a common event preceding cell transformation [[<reflink idref="bib69" id="ref57">69</reflink>]]. On the other hand, HPV integration occurs up to 42.8% of normal tissues, as previously reported in HPV-positive normal cervical samples [[<reflink idref="bib70" id="ref58">70</reflink>]]. Regard KP, evidences proving its neoplastic transformation do not exist, although some cases mimicking malignant transformation have been reported [[<reflink idref="bib71" id="ref59">71</reflink>]]. Nevertheless, HPV carcinogenesis in KP, if any, could be difficult to be assessed, since KPs are removed early after presentation, whereas HPV transformation process occurs in long lasting time, needing many years to be detected. Altogether, our data indicate that HPV16 is present at low DNA load in both episomal and integrated form, consistent with latent/persistent infection in the antral KP. Nevertheless, the detection of the oncogenic HPV16 combined with its DNA integration in the KP is intriguing. Further studies are needed to assess the HPV DNA integration in KP over the time.</p> <p>HPV mRNA expressions occur during active viral infection. Accordingly, in this study, viral expression of <emph>E2</emph>, <emph>E5</emph>, <emph>E6</emph> and <emph>E7</emph> sequences was not detected in the HPV-positive KP samples. Although <emph>E6/E7</emph> expression in HPV-positive KP samples carrying viral DNA integration would be expected, HPV latency in normal and pathological tissues presenting viral DNA integration is also common [[<reflink idref="bib72" id="ref60">72</reflink>]]. Some other explanations may account for lack of viral expression. For instance, KPs are covered by ciliated cylindrical epithelium, which may be not permissive for HPV <emph>E6/E7</emph> gene expression [[<reflink idref="bib7" id="ref61">7</reflink>], [<reflink idref="bib67" id="ref62">67</reflink>]]. Also, it is possible that viral mRNA levels were too low to be detected under our qPCR conditions. Further studies with more sensitive assays may clarify this matter [[<reflink idref="bib46" id="ref63">46</reflink>]].</p> <p>Since no HPV transcriptional activity was found, the surrogate marker of active HPV infection, the <emph>p16</emph>, was studied in correlation to infection. During HPV infection the viral E7 protein inactivates pRb tumor suppressor protein leading to p16 overexpression [[<reflink idref="bib73" id="ref64">73</reflink>]]. In this study, no difference between HPV16-positive KP samples carrying integrated viral DNA and HPV-negative KPs was observed (<emph>p</emph>> 0.05), although a slightly higher <emph>p16</emph> mRNA level was found in HPV16-positive KPs. Likely, the small samples size used in the study did not allow statistical significance to be reached. In contrast, the KP sample carrying episomal HPV DNA showed stronger <emph>p16</emph> down-expression compared to HPV-positive and HPV-negative KP samples (<emph>p</emph>< 0.001). Mutations at the <emph>p16</emph> coding gene may explain its down-expression [[<reflink idref="bib74" id="ref65">74</reflink>]]. Alternatively, methylation at <emph>p16</emph> promoter may silence the gene leading to decrease expression, as previously shown in HPV-positive samples carrying HPV in episomal form [[<reflink idref="bib76" id="ref66">76</reflink>]].</p> <p>Finally, HPyV DNA sequences were analyzed in KP. HPyVs have been found associated to different diseases, including cancer and polyposis [[<reflink idref="bib77" id="ref67">77</reflink>]]. Specifically, JCPyV has been studied in correlation to colon polyposis [[<reflink idref="bib78" id="ref68">78</reflink>]], whereas BKPyV has been investigated in the prostate and colon cancer onset [[<reflink idref="bib79" id="ref69">79</reflink>]]. MCPyV is the main cause of the Merkel cell carcinoma, a rare but very aggressive non-melanoma skin cancer [[<reflink idref="bib25" id="ref70">25</reflink>]]. Moreover, MCPyV is considered to be a part of the skin microbiota, and viral DNA sequences have been found in nasal swabs, blood, chorionic villi, eyebrows and adrenal glands [[<reflink idref="bib38" id="ref71">38</reflink>], [<reflink idref="bib77" id="ref72">77</reflink>], [<reflink idref="bib80" id="ref73">80</reflink>]]. In this study, HPyV sequences were not found neither in antral nor nasal KPs, thus excluding their role in KP formation.</p> <hd id="AN0147997086-17">Conclusions</hd> <p>The present study investigated HPV and HPyV as potential pathogenic risk factors in KP. While no implication was found for HPyV, a fraction of KPs showed positivity for HPV16. New information on HPV DNA load and physical status in KPs were also provided. Specifically, HPV16-positive KPs presented viral DNA at low load and in episomal or integrated form. The reduced sample size employed in this pilot study could be considered a limitation, and further studies in a larger samples size are needed, especially for clarifying the oncogenic HPV16 integration into the KPs. Of note, KP samples were divided in antral and nasal portions, whereas HPV sequences were found only in the antral region, providing a possible explanation for polyp formation from sinus maxillary infections. We suggest that a HPV latent infection of the maxillary sinus might be responsible for its recurrence, after KP surgical removal, highlighting the importance of complete surgical removal of the HPV-positive pathological tissue to prevent further recurrences.</p> <hd id="AN0147997086-18">Authors' contributions</hd> <p>For research articles with several authors, a short paragraph specifying their individual contributions must be provided. The following statements should be used "Conceptualization, F.M. and S.P.; methodology, L.O.G. and J.C.R..; software, M.D.M.; validation, M.T., S.P., F.M.; formal analysis, L.O.G., J.C.R.; investigation, L.O.G., J.C.R., C.L., C.M., I.B. M.D.M.,; resources, L.C., N.M., A.C., C.B., S.P.; data curation L.O.G., J.C.R., C.L., C.M., I.B..; writing-original draft preparation, L.O.G., J.C.R..; writing, review and editing, C.L., M.T., S.P., F.M..; visualization, L.O.G..; supervision, M.T., S.P., F.M..; project administration, M.T., S.P., F.M..; funding acquisition, J.C.R., M.T., F.M.. All authors have read and agreed to the published version of the manuscript.</p> <hd id="AN0147997086-19">Funding</hd> <p>This research was funded by the University of Ferrara, FAR grants (2017/2018 to MT and FM) and FIR grants 2016, 2017, 2018 to FM; Associazione Italiana per la Ricerca sul Cancro (AIRC), Milan, Contract grant number: IG 21617 to M.T. and 21956 to J.C.R.. J.C.R was a post-doctoral fellow of the Fondazione Umberto Veronesi, Milan, Italy (2019–2020).</p> <hd id="AN0147997086-20">Availability of data and materials</hd> <p>Data and material will be available upon request to the corresponding author.</p> <hd id="AN0147997086-21">Competing interests</hd> <p>The authors declare no conflict of interest.</p> <hd id="AN0147997086-22">Abbreviations</hd> <p></p> <p>• KP</p> <p></p> <ulist> <item> Killian polyp</item> <p></p> </ulist> <p>• HPV</p> <p></p> <ulist> <item> Human papillomavirus</item> <p></p> </ulist> <p>• HPyV</p> <p></p> <ulist> <item> Polyomaviruses</item> <p></p> </ulist> <p>• RCA</p> <p></p> <ulist> <item> Rolling circle amplifications</item> <p></p> </ulist> <p>• MCPyV</p> <p></p> <ulist> <item> Merkel cell polyomavirus</item> <p></p> </ulist> <p>• ssDNA</p> <p></p> <ulist> <item> Salmon sperm DNA</item> <p></p> </ulist> <p>• qPCR</p> <p></p> <ulist> <item> quantitative PCR</item> </ulist> <hd id="AN0147997086-23">Publisher's Note</hd> <p>Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.</p> <ref id="AN0147997086-24"> <title> References </title> <blist> <bibl id="bib1" idref="ref1" type="bt">1</bibl> <bibtext> Chaiyasate S, Roongrotwattanasiri K, Patumanond J, Fooanant S. Antrochoanal polyps: how long should follow-up be after surgery?. Int J Otolaryngol. 2015; 2015: 297417. 26339246. 4539068</bibtext> </blist> <blist> <bibl id="bib2" type="bt">2</bibl> <bibtext> Aksakal C. Bilateral antrochoanal polyp in a child. J Craniofac Surg. 2018; 29; 8: 2368-2369. 30320689. 10.1097/SCS.0000000000004947</bibtext> </blist> <blist> <bibl id="bib3" idref="ref2" type="bt">3</bibl> <bibtext> Frosini P, Picarella G, De Campora E. Antrochoanal polyp: analysis of 200 cases. Acta Otorhinolaryngol Ital Organo Uff Della Soc Ital Otorinolaringol E Chir Cerv-facc. 2009; 29; 1: 21-26. 1:STN:280:DC%2BD1MvptVCmtA%3D%3D</bibtext> </blist> <blist> <bibl id="bib4" idref="ref3" type="bt">4</bibl> <bibtext> Piquet JJ, Chevalier D, Leger GP, Rouquette I, Leconte-Houcke M. Endonasal microsurgery of antro-choanal polyps. Acta Otorhinolaryngol Belg. 1992; 46; 3: 267-271. 1:STN:280:DyaK3s%2FjsVaiuw%3D%3D. 1414308</bibtext> </blist> <blist> <bibl id="bib5" type="bt">5</bibl> <bibtext> Cook PR, Davis WE, McDonald R, McKinsey JP. Antrochoanal polyposis: a review of 33 cases. Ear Nose Throat J. 1993; 72; 6: 401-402. 1:STN:280:DyaK3szksFensg%3D%3D. 8344181. 10.1177/014556139307200607404–10</bibtext> </blist> <blist> <bibl id="bib6" idref="ref4" type="bt">6</bibl> <bibtext> Lee T-J, Huang S-F. Endoscopic sinus surgery for antrochoanal polyps in children. Otolaryngol--Head Neck Surg Off J Am Acad Otolaryngol-Head Neck Surg. 2006; 135; 5: 688-692. 10.1016/j.otohns.2006.02.035</bibtext> </blist> <blist> <bibl id="bib7" idref="ref5" type="bt">7</bibl> <bibtext> Hirshoren N, Neuman T, Gross M, Eliashar R. Angiogenesis in chronic rhinosinusitis with nasal polyps and in antrochoanal polyps. Inflamm Res. 2011; 60; 4: 321-327. 1:CAS:528:DC%2BC3MXjt1Wht7Y%3D. 20972696. 10.1007/s00011-010-0271-8</bibtext> </blist> <blist> <bibl id="bib8" idref="ref6" type="bt">8</bibl> <bibtext> Schryver ED, Calus L, Bonte H, Natalie DR, Gould H, Donovan E. The quest for autoreactive antibodies in nasal polyps. J Allergy Clin Immunol. 2016; 138; 3: 893-895.e5. 27283383. 5514560. 10.1016/j.jaci.2016.03.040</bibtext> </blist> <blist> <bibl id="bib9" idref="ref8" type="bt">9</bibl> <bibtext> Stierna PL. Nasal polyps: relationship to infection and inflammation. Allergy Asthma Proc. 1996; 17; 5: 251-257. 1:STN:280:DyaK2s%2FotVyjuw%3D%3D. 8922144. 10.2500/108854196778662282</bibtext> </blist> <blist> <bibtext> Yaman H, Yilmaz S, Karali E, Guclu E, Ozturk O. Evaluation and management of antrochoanal polyps. Clin Exp Otorhinolaryngol. 2010; 3; 2: 110. 20607082. 2896733. 10.3342/ceo.2010.3.2.110</bibtext> </blist> <blist> <bibtext> Kobayashi K, Hisamatsu K, Suzui N, Hara A, Tomita H, Miyazaki T. A review of HPV-related head and neck cancer. J Clin Med. 2018;7(9).</bibtext> </blist> <blist> <bibtext> Poluschkin L, Rautava J, Turunen A, Wang Y, Hedman K, Syrjänen K. Polyomaviruses detectable in head and neck carcinomas. Oncotarget. 2018; 9; 32: 22642-22652. 29854304. 5978254. 10.18632/oncotarget.25202</bibtext> </blist> <blist> <bibtext> Goudsmit J, Wertheim-van Dillen P, van Strien A, van der Noordaa J. The role of BK virus in acute respiratory tract disease and the presence of BKV DNA in tonsils. J Med Virol. 1982; 10; 2: 91-99. 1:STN:280:DyaL3s%2FlvVOgtQ%3D%3D. 6292361. 10.1002/jmv.1890100203</bibtext> </blist> <blist> <bibtext> Monaco MC, Jensen PN, Hou J, Durham LC, Major EO. Detection of JC virus DNA in human tonsil tissue: evidence for site of initial viral infection. J Virol. 1998; 72; 12: 9918-9923. 1:CAS:528:DyaK1cXns1Sgu7c%3D. 9811728. 110504. 10.1128/JVI.72.12.9918-9923.1998</bibtext> </blist> <blist> <bibtext> Kantola K, Sadeghi M, Lahtinen A, Koskenvuo M, Aaltonen L-M, Möttönen M. Merkel cell polyomavirus DNA in tumor-free tonsillar tissues and upper respiratory tract samples: implications for respiratory transmission and latency. J Clin Virol Off Publ Pan Am Soc Clin Virol. 2009; 45; 4: 292-295. 1:CAS:528:DC%2BD1MXosVahtLg%3D. 10.1016/j.jcv.2009.04.008</bibtext> </blist> <blist> <bibtext> Rieth KKS, Gill SR, Lott-Limbach AA, Merkley MA, Botero N, Allen PD. Prevalence of high-risk human papillomavirus in tonsil tissue in healthy adults and colocalization in biofilm of tonsillar crypts. JAMA Otolaryngol-- Head Neck Surg. 2018; 144; 3: 231-237. 29372248. 5885877. 10.1001/jamaoto.2017.2916</bibtext> </blist> <blist> <bibtext> Bialasiewicz S, Lambert SB, Whiley DM, Nissen MD, Sloots TP. Merkel cell polyomavirus DNA in respiratory specimens from children and adults. Emerg Infect Dis. 2009; 15; 3: 492-494. 1:CAS:528:DC%2BD1MXjs12qs74%3D. 19239774. 2681122. 10.3201/eid1503.081067</bibtext> </blist> <blist> <bibtext> Abedi Kiasari B, Vallely PJ, Klapper PE. Merkel cell polyomavirus DNA in immunocompetent and immunocompromised patients with respiratory disease. J Med Virol. 2011; 83; 12: 2220-2224. 1:CAS:528:DC%2BC3MXhtleqsrnK. 22012732. 7166447. 10.1002/jmv.22222</bibtext> </blist> <blist> <bibtext> Gillison ML, Alemany L, Snijders PJF, Chaturvedi A, Steinberg BM, Schwartz S. Human papillomavirus and diseases of the upper airway: head and neck cancer and respiratory papillomatosis. Vaccine. 2012; 30; Suppl 5: F34-F54. 23199965. 10.1016/j.vaccine.2012.05.070</bibtext> </blist> <blist> <bibtext> Shikova E, Emin D, Alexandrova D, Shindov M, Kumanova А, Lekov A. Detection of merkel cell polyomavirus in respiratory tract specimens. Intervirology. 2017; 60; 1–2: 28-32. 1:CAS:528:DC%2BC2sXhs1Wgt7nK. 28848124. 10.1159/000479372</bibtext> </blist> <blist> <bibtext> Rotondo JC, Mazzoni E, Bononi I, Tognon M, Martini F. Association between human tumours and simian virus 40. Fontiers Oncol. 2019;9 In press.</bibtext> </blist> <blist> <bibtext> Krump NA, Liu W, You J. Mechanisms of persistence by small DNA tumor viruses. Curr Opin Virol. 2018; 32: 71-79. 1:CAS:528:DC%2BC1cXhslGmurvN. 30278284. 6263785. 10.1016/j.coviro.2018.09.002</bibtext> </blist> <blist> <bibtext> Egawa N, Egawa K, Griffin H, Doorbar J. Human papillomaviruses; epithelial tropisms, and the development of neoplasia. Viruses. 2015; 7; 7: 3863-3890. 1:CAS:528:DC%2BC2MXhslOqt73K. 26193301. 4517131. 10.3390/v7072802</bibtext> </blist> <blist> <bibtext> Preti M, Rotondo JC, Holzinger D, Micheletti L, Gallio N, McKay-Chopin S. Role of human papillomavirus infection in the etiology of vulvar cancer in Italian women. Infect Agent Cancer. 2020; 15: 20. 1:CAS:528:DC%2BB3cXmtFyltLc%3D. 32266002. 7110671. 10.1186/s13027-020-00286-8</bibtext> </blist> <blist> <bibtext> Rotondo JC, Bononi I, Puozzo A, Govoni M, Foschi V, Lanza G. Merkel cell carcinomas arising in autoimmune disease affected patients treated with biologic drugs, including anti-TNF. Clin Cancer Res. 2017; 23; 14: 3929-3934. 1:CAS:528:DC%2BC2sXhtFKiurnK. 28174236. 10.1158/1078-0432.CCR-16-2899</bibtext> </blist> <blist> <bibtext> Pei F, Chen X-P, Zhang Y, Wang Y, Chen Q, Tan X-J. Human papillomavirus infection in nasal polyps in a Chinese population. J Gen Virol. 2011; 92; Pt 8: 1795-1799. 1:CAS:528:DC%2BC3MXpvFektLk%3D. 21562117. 10.1099/vir.0.031955-0</bibtext> </blist> <blist> <bibtext> Knör M, Tziridis K, Agaimy A, Zenk J, Wendler O. Human papillomavirus (HPV) prevalence in nasal and antrochoanal polyps and association with clinical data. PLoS One. 2015; 10; 10: e0141722. 26509801. 4624970. 10.1371/journal.pone.0141722. 1:CAS:528:DC%2BC2MXhvFOitLnI</bibtext> </blist> <blist> <bibtext> Yılmaz E, Alatas N, Ucar F, Cora T, Buruk K, Unlu Y. Investigation of human papillomavirus (HPV) and epstein-barr virus (EBV) in antrochoanal polyps. Am J Otolaryngol. 2019; 40; 3: 389-392. 30808528. 10.1016/j.amjoto.2019.02.008</bibtext> </blist> <blist> <bibtext> McBride AA, Warburton A. The role of integration in oncogenic progression of HPV-associated cancers. PLoS Pathog. 2017; 13; 4: e1006211. 28384274. 5383336. 10.1371/journal.ppat.1006211. 1:CAS:528:DC%2BC2sXht1SlurfP</bibtext> </blist> <blist> <bibtext> Rotondo JC, Candian T, Selvatici R, Mazzoni E, Bonaccorsi G, Greco P. Tracing males from different continents by genotyping JC polyomavirus in DNA from semen samples. J Cell Physiol. 2017; 232; 5: 982-985. 1:CAS:528:DC%2BC28XhvVymt7jO. 27859215. 10.1002/jcp.25686</bibtext> </blist> <blist> <bibtext> Rotondo JC, Giari L, Guerranti C, Tognon M, Castaldelli G, Fano EA. Environmental doses of perfluorooctanoic acid change the expression of genes in target tissues of common carp. Environ Toxicol Chem. 2018; 37; 3: 942-948. 1:CAS:528:DC%2BC1cXjt1Kmtg%3D%3D. 29105837. 10.1002/etc.4029</bibtext> </blist> <blist> <bibtext> Contini C, Rotondo JC, Magagnoli F, Maritati M, Seraceni S, Graziano A. Investigation on silent bacterial infections in specimens from pregnant women affected by spontaneous miscarriage. J Cell Physiol. 2018; 234; 1: 100-107. 30078192. 10.1002/jcp.26952. 1:CAS:528:DC%2BC1cXhsVCgtLrJ</bibtext> </blist> <blist> <bibtext> Malagutti N, Rotondo JC, Cerritelli L, Melchiorri C, De Mattei M, Selvatici R, et al. High human papillomavirus DNA loads in inflammatory middle ear diseases. Pathog Basel Switz. 2020;9(3).</bibtext> </blist> <blist> <bibtext> Tognon M, Tagliapietra A, Magagnoli F, Mazziotta C, Oton-Gonzalez L, Lanzillotti C. Investigation on spontaneous abortion and human papillomavirus infection. Vaccines. 2020; 8; 3: 473. 7563606. 10.3390/vaccines8030473. 7563606</bibtext> </blist> <blist> <bibtext> Rotondo JC, Oton-Gonzalez L, Mazziotta C, Lanzillotti C, Iaquinta MR, Tognon M, et al. Simultaneous detection and viral DNA load quantification of different human papillomavirus types in clinical specimens by the high analytical droplet digital PCR method. Front Microbiol. 2020; In press. Available at: https://<ulink href="http://www.frontiersin.org/articles/10.3389/fmicb.2020.591452/abstract">www.frontiersin.org/articles/10.3389/fmicb.2020.591452/abstract</ulink>.</bibtext> </blist> <blist> <bibtext> Evans MF, Adamson CSC, Simmons-Arnold L, Cooper K. Touchdown General Primer (GP5+/GP6+) PCR and optimized sample DNA concentration support the sensitive detection of human papillomavirus. BMC Clin Pathol. 2005; 5: 10. 16288661. 16288661. 10.1186/1472-6890-5-10. 1:CAS:528:DC%2BD28XjslOh</bibtext> </blist> <blist> <bibtext> Peitsaro P, Johansson B, Syrjanen S. Integrated human papillomavirus type 16 is frequently found in cervical cancer precursors as demonstrated by a novel quantitative real-time PCR technique. J Clin Microbiol. 2002; 40; 3: 886-891. 1:CAS:528:DC%2BD38XisVKrs7o%3D. 11880410. 120275. 10.1128/JCM.40.3.886-891.2002</bibtext> </blist> <blist> <bibtext> Tagliapietra A, Rotondo JC, Bononi I, Mazzoni E, Magagnoli F, Oton Gonzalez L, et al. Droplet-digital PCR assay to detect Merkel cell polyomavirus sequences in chorionic villi from spontaneous abortion affected females. J Cell Physiol. 2020.</bibtext> </blist> <blist> <bibtext> Tagliapietra A, Rotondo JC, Bononi I, Mazzoni E, Magagnoli F, Maritati M, et al. Footprints of BK and JC polyomaviruses in specimens from females affected by spontaneous abortion. Hum Reprod Oxf Engl. 2019.</bibtext> </blist> <blist> <bibtext> Weyn C, Vanderwinden J-M, Rasschaert J, Englert Y, Fontaine V. Regulation of human papillomavirus type 16 early gene expression in trophoblastic and cervical cells. Virology. 2011; 412; 1: 146-155. 1:CAS:528:DC%2BC3MXjtFerur4%3D. 21276600. 10.1016/j.virol.2010.12.056</bibtext> </blist> <blist> <bibtext> Pett MR, Herdman MT, Palmer RD, Yeo GSH, Shivji MK, Stanley MA. Selection of cervical keratinocytes containing integrated HPV16 associates with episome loss and an endogenous antiviral response. Proc Natl Acad Sci. 2006; 103; 10: 3822-3827. 1:CAS:528:DC%2BD28XivFWisLs%3D. 16505361. 10.1073/pnas.0600078103</bibtext> </blist> <blist> <bibtext> Marcoux S, Le ONL, Langlois-Pelletier C, Laverdière C, Hatami A, Robaey P. Expression of the senescence marker p16INK4a in skin biopsies of acute lymphoblastic leukemia survivors: a pilot study. Radiat Oncol Lond Engl. 2013; 8: 252. 10.1186/1748-717X-8-252. 1:CAS:528:DC%2BC2cXjslaksr0%3D</bibtext> </blist> <blist> <bibtext> Xiao Z, Liu Q, Mao F, Wu J, Lei T. TNF-α-induced VEGF and MMP-9 expression promotes hemorrhagic transformation in pituitary adenomas. Int J Mol Sci. 2011; 12; 6: 4165-4179. 1:CAS:528:DC%2BC3MXotF2msbw%3D. 21747731. 3131615. 10.3390/ijms12064165</bibtext> </blist> <blist> <bibtext> de Araujo MR, De Marco L, Santos CF, Rubira-Bullen IRF, Ronco G, Pennini I. GP5+/6+ SYBR green methodology for simultaneous screening and quantification of human papillomavirus. J Clin Virol Off Publ Pan Am Soc Clin Virol. 2009; 45; 2: 90-95. 10.1016/j.jcv.2009.03.020. 1:CAS:528:DC%2BD1MXms1ygt7o%3D</bibtext> </blist> <blist> <bibtext> da Silva FRC, Cibulski SP, Daudt C, Weber MN, Guimarães LLB, Streck AF. Novel bovine papillomavirus type discovered by rolling-circle amplification coupled with next-generation sequencing. Aguayo FR, curatore. PLoS ONE. 2016; 11; 9: e0162345. 27606703. 5015974. 10.1371/journal.pone.0162345. 1:CAS:528:DC%2BC2sXhvFCjsbw%3D</bibtext> </blist> <blist> <bibtext> Torreggiani E, Rossini M, Bononi I, Pietrobon S, Mazzoni E, Iaquinta MR. Protocol for the long-term culture of human primary keratinocytes from the normal colorectal mucosa. J Cell Physiol. 2019; 234; 7: 9895-9905. 1:CAS:528:DC%2BC1MXis1Grs7w%3D. 30740692. 10.1002/jcp.28300</bibtext> </blist> <blist> <bibtext> Rotondo JC, Borghi A, Selvatici R, Mazzoni E, Bononi I, Corazza M. Association of retinoic acid receptor β gene with onset and progression of lichen sclerosus–associated vulvar squamous cell carcinoma. JAMA Dermatol. 2018; 154; 7: 819. 29898214. 6128494. 10.1001/jamadermatol.2018.1373Available at: <ulink href="http://archderm.jamanetwork.com/article.aspx?doi=10.1001/jamadermatol.2018.1373">http://archderm.jamanetwork.com/article.aspx?doi=10.1001/jamadermatol.2018.1373</ulink>. [citato 8 gennaio 2019]</bibtext> </blist> <blist> <bibtext> Mazzoni E, Martini F, Corallini A, Taronna A, Barbanti-Brodano G, Querzoli P. Serologic investigation of undifferentiated nasopharyngeal carcinoma and simian virus 40 infection. Head Neck. 2016; 38; 2: 232-236. 25244358. 10.1002/hed.23879</bibtext> </blist> <blist> <bibtext> Rotondo JC, Oton-Gonzalez L, Selvatici R, Rizzo P, Pavasini R, Campo GC, et al. SERPINA1 gene promoter is differentially methylated in peripheral blood mononuclear cells of pregnant women. Front Cell Dev Biol. 2020;8 Available at: https://<ulink href="http://www.frontiersin.org/article/10.3389/fcell.2020.550543/full">www.frontiersin.org/article/10.3389/fcell.2020.550543/full</ulink>. [citato 3 settembre 2020].</bibtext> </blist> <blist> <bibtext> Mazzoni E, Pietrobon S, Masini I, Rotondo JC, Gentile M, Fainardi E. Significant low prevalence of antibodies reacting with simian virus 40 mimotopes in serum samples from patients affected by inflammatory neurologic diseases, including multiple sclerosis. PLoS One. 2014; 9; 11: e110923. 25365364. 4218715. 10.1371/journal.pone.0110923. 1:CAS:528:DC%2BC2cXhvFKjtbrN</bibtext> </blist> <blist> <bibtext> Mazzoni E, Di Stefano M, Fiore JR, Destro F, Manfrini M, Rotondo JC. Serum IgG antibodies from pregnant women reacting to mimotopes of simian virus 40 large T antigen, the viral oncoprotein. Front Immunol. 2017; 8: 411. 28443094. 5385463. 10.3389/fimmu.2017.00411. 1:CAS:528:DC%2BC1cXhsVehsb3O</bibtext> </blist> <blist> <bibtext> Galluzzi F, Pignataro L, Maddalone M, Garavello W. Recurrences of surgery for antrochoanal polyps in children: A systematic review. Int J Pediatr Otorhinolaryngol. 2018; 106: 26-30. 29447886. 10.1016/j.ijporl.2017.12.035</bibtext> </blist> <blist> <bibtext> Hong SK, Min YG, Kim CN, Byun SW. Endoscopic removal of the antral portion of antrochoanal polyp by powered instrumentation. Laryngoscope. 2001; 111; 10: 1774-1778. 1:STN:280:DC%2BD38%2Fntlensw%3D%3D. 11801944. 10.1097/00005537-200110000-00021</bibtext> </blist> <blist> <bibtext> Becker M, Forslund O, Hansson BG, Malm L. Search for the human papillomavirus in nasal polyps, using a polymerase chain reaction-method. J Otolaryngol. 1994; 23; 5: 344-346. 1:STN:280:DyaK2M7gs1equg%3D%3D. 7807638</bibtext> </blist> <blist> <bibtext> Hoffmann M, Kahn T, Goeroegh T, Lohrey C, Gottschlich S, Meyer J. Tracing human papillomavirus DNA in nasal polyps by polymerase chain reaction. Acta Otolaryngol (Stockh). 2000; 120; 7: 872-875. 1:CAS:528:DC%2BD38XlsFChs7o%3D. 10.1080/000164800750061750</bibtext> </blist> <blist> <bibtext> Hoffmann M, Klose N, Gottschlich S, Görögh T, Fazel A, Lohrey C. Detection of human papillomavirus DNA in benign and malignant sinonasal neoplasms. Cancer Lett. 2006; 239; 1: 64-70. 1:CAS:528:DC%2BD28Xms1agt7Y%3D. 16135399. 10.1016/j.canlet.2005.07.019</bibtext> </blist> <blist> <bibtext> Zaravinos A, Bizakis J, Spandidos DA. Prevalence of human papilloma virus and human herpes virus types 1-7 in human nasal polyposis. J Med Virol. 2009; 81; 9: 1613-1619. 1:CAS:528:DC%2BD1MXhtVaiurjN. 19626617. 10.1002/jmv.21534</bibtext> </blist> <blist> <bibtext> Sham CL, Tol KF, Chan PKS, Lee DLY, Tong MCF, van Hasselt CA. Prevalence of human papillomavirus, Epstein-Barr virus, p21, and p53 expression in sinonasal inverted papilloma, nasal polyp, and hypertrophied turbinate in Hong Kong patients. Head Neck. 2012; 34; 4: 520-533. 1:STN:280:DC%2BC383nvFCisg%3D%3D. 21608063. 10.1002/hed.21772</bibtext> </blist> <blist> <bibtext> Rizzo R, Malagutti N, Bortolotti D, Gentili V, Rotola A, Fainardi E. Infection and HLA-G molecules in nasal polyposis. J Immunol Res. 2014; 2014: 407430. 24741599. 3987795. 10.1155/2014/407430. 1:CAS:528:DC%2BC2MXjtlWktbk%3D</bibtext> </blist> <blist> <bibtext> Pagella F, Emanuelli E, Pusateri A, Borsetto D, Cazzador D, Marangoni R. Clinical features and management of antrochoanal polyps in children: cues from a clinical series of 58 patients. Int J Pediatr Otorhinolaryngol. 2018; 114: 87-91. 30262373. 10.1016/j.ijporl.2018.08.033</bibtext> </blist> <blist> <bibtext> Burd EM. Human papillomavirus and cervical cancer. Clin Microbiol Rev. 2003; 16; 1: 1-17. 1:CAS:528:DC%2BD3sXht1Wqt7s%3D. 12525422. 145302. 10.1128/CMR.16.1.1-17.2003</bibtext> </blist> <blist> <bibtext> Ramakrishnan S, Partricia S, Mathan G. Overview of high-risk HPV's 16 and 18 infected cervical cancer: pathogenesis to prevention. Biomed Pharmacother Biomedecine Pharmacother. 2015; 70: 103-110. 1:CAS:528:DC%2BC2MXovFWitw%3D%3D. 10.1016/j.biopha.2014.12.041</bibtext> </blist> <blist> <bibtext> Nicolás-Párraga S, Gandini C, Pimenoff VN, Alemany L, de Sanjosé S, Xavier Bosch F. HPV16 variants distribution in invasive cancers of the cervix, vulva, vagina, penis, and anus. Cancer Med. 2016; 5; 10: 2909-2919. 27654117. 5083745. 10.1002/cam4.870. 1:CAS:528:DC%2BC28XhslKlsbvL</bibtext> </blist> <blist> <bibtext> Geißler C, Tahtali A, Diensthuber M, Gassner D, Stöver T, Wagenblast J. The role of p16 expression as a predictive marker in HPV-positive oral SCCHN--a retrospective single-center study. Anticancer Res. 2013; 33; 3: 913-916. 23482761</bibtext> </blist> <blist> <bibtext> Castellsagué X, Alemany L, Quer M, Halec G, Quirós B, Tous S. HPV involvement in head and neck cancers: comprehensive assessment of biomarkers in 3680 patients. J Natl Cancer Inst. 2016; 108; 6: djv403. 26823521. 10.1093/jnci/djv403. 1:CAS:528:DC%2BC1cXivFOkt70%3D</bibtext> </blist> <blist> <bibtext> Shukla S, Mahata S, Shishodia G, Pande S, Verma G, Hedau S. Physical state & copy number of high risk human papillomavirus type 16 DNA in progression of cervical cancer. Indian J Med Res. 2014; 139; 4: 531-543. 1:CAS:528:DC%2BC2cXhsVChsLvJ. 24927339. 4078491</bibtext> </blist> <blist> <bibtext> Abramson AL, Nouri M, Mullooly V, Fisch G, Steinberg BM. Latent human papillomavirus infection is comparable in the larynx and trachea. J Med Virol. 2004; 72; 3: 473-477. 14748072. 10.1002/jmv.20013</bibtext> </blist> <blist> <bibtext> Kalantari M, Garcia-Carranca A, Morales-Vazquez CD, Zuna R, Montiel DP, Calleja-Macias IE. Laser capture microdissection of cervical human papillomavirus infections: Copy number of the virus in cancerous and normal tissue and heterogeneous DNA methylation. Virology. 2009; 390; 2: 261-267. 1:CAS:528:DC%2BD1MXosV2itr4%3D. 19497607. 2753400. 10.1016/j.virol.2009.05.006</bibtext> </blist> <blist> <bibtext> Münger K, Baldwin A, Edwards KM, Hayakawa H, Nguyen CL, Owens M. Mechanisms of human papillomavirus-induced oncogenesis. J Virol. 2004; 78; 21: 11451-11460. 15479788. 523272. 10.1128/JVI.78.21.11451-11460.2004. 1:CAS:528:DC%2BD2cXptVKmur4%3D</bibtext> </blist> <blist> <bibtext> Huang J, Qian Z, Gong Y, Wang Y, Guan Y, Han Y. Comprehensive genomic variation profiling of cervical intraepithelial neoplasia and cervical cancer identifies potential targets for cervical cancer early warning. J Med Genet. 2019; 56; 3: 186-194. 1:CAS:528:DC%2BC1MXhvV2gt7vO. 30567904. 10.1136/jmedgenet-2018-105745</bibtext> </blist> <blist> <bibtext> Thakur JS, Chaitanya A, Minhas RS, Azad RK, Sharma DR, Mohindroo NK. Killian's polyp mimicking malignant tumor. Ann Maxillofac Surg. 2015; 5; 2: 281-283. 26981490. 4772580. 10.4103/2231-0746.175775</bibtext> </blist> <blist> <bibtext> Leonard SM, Pereira M, Roberts S, Cuschieri K, Nuovo G, Athavale R. Evidence of disrupted high-risk human papillomavirus DNA in morphologically normal cervices of older women. Sci Rep. 2016; 6: 20847. 1:CAS:528:DC%2BC28XisFKht7g%3D. 26875676. 4753489. 10.1038/srep20847</bibtext> </blist> <blist> <bibtext> Romagosa C, Simonetti S, López-Vicente L, Mazo A, Lleonart ME, Castellvi J. p16(Ink4a) overexpression in cancer: a tumor suppressor gene associated with senescence and high-grade tumors. Oncogene. 2011; 30; 18: 2087-2097. 1:CAS:528:DC%2BC3MXhsFyqur4%3D. 21297668. 10.1038/onc.2010.614</bibtext> </blist> <blist> <bibtext> Hibi K, Koike M, Nakayama H, Fujitake S, Kasai Y, Ito K. A cancer-prone case with a background of methylation of p16 tumor suppressor gene. Clin Cancer Res Off J Am Assoc Cancer Res. 2003; 9; 3: 1053-1056. 1:CAS:528:DC%2BD3sXhvFKitL8%3D</bibtext> </blist> <blist> <bibtext> Wong DJ, Paulson TG, Prevo LJ, Galipeau PC, Longton G, Blount PL. p16(INK4a) lesions are common, early abnormalities that undergo clonal expansion in Barrett's metaplastic epithelium. Cancer Res. 2001; 61; 22: 8284-8289. 1:CAS:528:DC%2BD3MXovVShsbo%3D. 11719461</bibtext> </blist> <blist> <bibtext> Carestiato FN, Amaro-Filho SM, Moreira MAM, Cavalcanti SMB. Methylation of p16 ink4a promoter is independent of human papillomavirus DNA physical state: a comparison between cervical pre-neoplastic and neoplastic samples. Mem Inst Oswaldo Cruz. 2018; 114: e180456. 30569945. 6319029. 10.1590/0074-02760180456. 1:CAS:528:DC%2BC1MXitFGltrfM</bibtext> </blist> <blist> <bibtext> Prado JCM, Monezi TA, Amorim AT, Lino V, Paladino A, Boccardo E. Human polyomaviruses and cancer: an overview. Clin Sao Paulo Braz. 2018; 73; suppl 1: e558s</bibtext> </blist> <blist> <bibtext> Coelho TR, Gaspar R, Figueiredo P, Mendonça C, Lazo PA, Almeida L. Human JC polyomavirus in normal colorectal mucosa, hyperplastic polyps, sporadic adenomas, and adenocarcinomas in Portugal: JCV presence in normal or abnormal colorectal mucosa. J Med Virol. 2013; 85; 12: 2119-2127. 1:CAS:528:DC%2BC3sXhsF2htbvO. 24009184. 10.1002/jmv.23705</bibtext> </blist> <blist> <bibtext> Tognon M, Corallini A, Martini F, Negrini M, Barbanti-Brodano G. Oncogenic transformation by BK virus and association with human tumors. Oncogene. 2003; 22; 33: 5192-5200. 1:CAS:528:DC%2BD3sXmtFahuro%3D. 12910256. 10.1038/sj.onc.1206550</bibtext> </blist> <blist> <bibtext> Mazzoni E, Rotondo JC, Marracino L, Selvatici R, Bononi I, Torreggiani E. Detection of merkel cell polyomavirus DNA in serum samples of healthy blood donors. Front Oncol. 2017; 7: 294. 29238698. 5712532. 10.3389/fonc.2017.00294</bibtext> </blist> </ref> <aug> <p>By Lucia Oton-Gonzalez; John Charles Rotondo; Luca Cerritelli; Nicola Malagutti; Carmen Lanzillotti; Ilaria Bononi; Andrea Ciorba; Chiara Bianchini; Chiara Mazziotta; Monica De Mattei; Stefano Pelucchi; Mauro Tognon and Fernanda Martini</p> <p>Reported by Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author</p> </aug> <nolink nlid="nl1" bibid="bib11" firstref="ref9"></nolink> <nolink nlid="nl2" bibid="bib13" firstref="ref10"></nolink> <nolink nlid="nl3" bibid="bib16" firstref="ref11"></nolink> <nolink nlid="nl4" bibid="bib17" firstref="ref12"></nolink> <nolink nlid="nl5" bibid="bib20" firstref="ref13"></nolink> <nolink nlid="nl6" bibid="bib21" firstref="ref14"></nolink> <nolink nlid="nl7" bibid="bib25" firstref="ref16"></nolink> <nolink nlid="nl8" bibid="bib26" firstref="ref17"></nolink> <nolink nlid="nl9" bibid="bib28" firstref="ref18"></nolink> <nolink nlid="nl10" bibid="bib27" firstref="ref19"></nolink> <nolink nlid="nl11" bibid="bib29" firstref="ref20"></nolink> <nolink nlid="nl12" bibid="bib30" firstref="ref21"></nolink> <nolink nlid="nl13" bibid="bib31" firstref="ref22"></nolink> <nolink nlid="nl14" bibid="bib32" firstref="ref23"></nolink> <nolink nlid="nl15" bibid="bib33" firstref="ref24"></nolink> <nolink nlid="nl16" bibid="bib35" firstref="ref25"></nolink> <nolink nlid="nl17" bibid="bib38" firstref="ref28"></nolink> <nolink nlid="nl18" bibid="bib44" firstref="ref32"></nolink> <nolink nlid="nl19" bibid="bib37" firstref="ref33"></nolink> <nolink nlid="nl20" bibid="bib45" firstref="ref34"></nolink> <nolink nlid="nl21" bibid="bib46" firstref="ref35"></nolink> <nolink nlid="nl22" bibid="bib40" firstref="ref37"></nolink> <nolink nlid="nl23" bibid="bib42" firstref="ref38"></nolink> <nolink nlid="nl24" bibid="bib47" firstref="ref39"></nolink> <nolink nlid="nl25" bibid="bib43" firstref="ref40"></nolink> <nolink nlid="nl26" bibid="bib48" firstref="ref41"></nolink> <nolink nlid="nl27" bibid="bib50" firstref="ref43"></nolink> <nolink nlid="nl28" bibid="bib51" firstref="ref44"></nolink> <nolink nlid="nl29" bibid="bib52" firstref="ref45"></nolink> <nolink nlid="nl30" bibid="bib54" firstref="ref47"></nolink> <nolink nlid="nl31" bibid="bib60" firstref="ref48"></nolink> <nolink nlid="nl32" bibid="bib24" firstref="ref50"></nolink> <nolink nlid="nl33" bibid="bib61" firstref="ref51"></nolink> <nolink nlid="nl34" bibid="bib63" firstref="ref52"></nolink> <nolink nlid="nl35" bibid="bib64" firstref="ref53"></nolink> <nolink nlid="nl36" bibid="bib66" firstref="ref55"></nolink> <nolink nlid="nl37" bibid="bib67" firstref="ref56"></nolink> <nolink nlid="nl38" bibid="bib69" firstref="ref57"></nolink> <nolink nlid="nl39" bibid="bib70" firstref="ref58"></nolink> <nolink nlid="nl40" bibid="bib71" firstref="ref59"></nolink> <nolink nlid="nl41" bibid="bib72" firstref="ref60"></nolink> <nolink nlid="nl42" bibid="bib73" firstref="ref64"></nolink> <nolink nlid="nl43" bibid="bib74" firstref="ref65"></nolink> <nolink nlid="nl44" bibid="bib76" firstref="ref66"></nolink> <nolink nlid="nl45" bibid="bib77" firstref="ref67"></nolink> <nolink nlid="nl46" bibid="bib78" firstref="ref68"></nolink> <nolink nlid="nl47" bibid="bib79" firstref="ref69"></nolink> <nolink nlid="nl48" bibid="bib80" firstref="ref73"></nolink>
CustomLinks:
  – Url: https://resolver.ebsco.com/c/xy5jbn/result?sid=EBSCO:edsdoj&genre=article&issn=17509378&ISBN=&volume=16&issue=1&date=20210101&spage=1&pages=1-9&title=Infectious Agents and Cancer&atitle=Association%20between%20oncogenic%20human%20papillomavirus%20type%2016%20and%20Killian%20polyp&aulast=Lucia%20Oton-Gonzalez&id=DOI:10.1186/s13027-020-00342-3
    Name: Full Text Finder (for New FTF UI) (s8985755)
    Category: fullText
    Text: Find It @ SCU Libraries
    MouseOverText: Find It @ SCU Libraries
  – Url: https://doaj.org/article/d550ee448cf644c49aefe8ea20ffdcc5
    Name: EDS - DOAJ (s8985755)
    Category: fullText
    Text: View record from DOAJ
    MouseOverText: View record from DOAJ
Header DbId: edsdoj
DbLabel: Directory of Open Access Journals
An: edsdoj.550ee448cf644c49aefe8ea20ffdcc5
RelevancyScore: 944
AccessLevel: 3
PubType: Academic Journal
PubTypeId: academicJournal
PreciseRelevancyScore: 943.9462890625
IllustrationInfo
Items – Name: Title
  Label: Title
  Group: Ti
  Data: Association between oncogenic human papillomavirus type 16 and Killian polyp
– Name: Author
  Label: Authors
  Group: Au
  Data: <searchLink fieldCode="AR" term="%22Lucia+Oton-Gonzalez%22">Lucia Oton-Gonzalez</searchLink><br /><searchLink fieldCode="AR" term="%22John+Charles+Rotondo%22">John Charles Rotondo</searchLink><br /><searchLink fieldCode="AR" term="%22Luca+Cerritelli%22">Luca Cerritelli</searchLink><br /><searchLink fieldCode="AR" term="%22Nicola+Malagutti%22">Nicola Malagutti</searchLink><br /><searchLink fieldCode="AR" term="%22Carmen+Lanzillotti%22">Carmen Lanzillotti</searchLink><br /><searchLink fieldCode="AR" term="%22Ilaria+Bononi%22">Ilaria Bononi</searchLink><br /><searchLink fieldCode="AR" term="%22Andrea+Ciorba%22">Andrea Ciorba</searchLink><br /><searchLink fieldCode="AR" term="%22Chiara+Bianchini%22">Chiara Bianchini</searchLink><br /><searchLink fieldCode="AR" term="%22Chiara+Mazziotta%22">Chiara Mazziotta</searchLink><br /><searchLink fieldCode="AR" term="%22Monica+De+Mattei%22">Monica De Mattei</searchLink><br /><searchLink fieldCode="AR" term="%22Stefano+Pelucchi%22">Stefano Pelucchi</searchLink><br /><searchLink fieldCode="AR" term="%22Mauro+Tognon%22">Mauro Tognon</searchLink><br /><searchLink fieldCode="AR" term="%22Fernanda+Martini%22">Fernanda Martini</searchLink>
– Name: TitleSource
  Label: Source
  Group: Src
  Data: Infectious Agents and Cancer, Vol 16, Iss 1, Pp 1-9 (2021)
– Name: Publisher
  Label: Publisher Information
  Group: PubInfo
  Data: BMC, 2021.
– Name: DatePubCY
  Label: Publication Year
  Group: Date
  Data: 2021
– Name: Subset
  Label: Collection
  Group: HoldingsInfo
  Data: LCC:Neoplasms. Tumors. Oncology. Including cancer and carcinogens<br />LCC:Infectious and parasitic diseases
– Name: Subject
  Label: Subject Terms
  Group: Su
  Data: <searchLink fieldCode="DE" term="%22Killian+polyp%22">Killian polyp</searchLink><br /><searchLink fieldCode="DE" term="%22Human+papillomavirus%22">Human papillomavirus</searchLink><br /><searchLink fieldCode="DE" term="%22Polyomavirus%22">Polyomavirus</searchLink><br /><searchLink fieldCode="DE" term="%22Infection%22">Infection</searchLink><br /><searchLink fieldCode="DE" term="%22Nasal+polyps%22">Nasal polyps</searchLink><br /><searchLink fieldCode="DE" term="%22Neoplasms%2E+Tumors%2E+Oncology%2E+Including+cancer+and+carcinogens%22">Neoplasms. Tumors. Oncology. Including cancer and carcinogens</searchLink><br /><searchLink fieldCode="DE" term="%22RC254-282%22">RC254-282</searchLink><br /><searchLink fieldCode="DE" term="%22Infectious+and+parasitic+diseases%22">Infectious and parasitic diseases</searchLink><br /><searchLink fieldCode="DE" term="%22RC109-216%22">RC109-216</searchLink>
– Name: Abstract
  Label: Description
  Group: Ab
  Data: Abstract Background Killian polyp (KP) is a benign lesion that arises from the maxillary sinus. The etiology of KP is unknown. The aim of this study was to investigate the potential involvement of human papilloma- (HPV) and polyoma-viruses (HPyV) infections in the onset of KP. Methods DNA from antral (n = 14) and nasal (n = 14) KP fractions were analyzed for HPV and HPyV sequences, genotypes, viral DNA load and physical status along with expression of viral proteins and p16 cellular protein. Results The oncogenic HPV16 was detected in 3/14 (21.4%) antral KPs, whilst nasal KPs tested HPV-negative (0/14). The mean HPV16 DNA load was 4.65 ± 2.64 copy/104 cell. The whole HPV16 episomal genome was detected in one KP sample, whereas HPV16 DNA integration in two KPs. P16 mRNA level was lower in the KP sample carrying HPV16 episome than in KPs carrying integrated HPV16 and HPV- negative KPs (p
– Name: TypeDocument
  Label: Document Type
  Group: TypDoc
  Data: article
– Name: Format
  Label: File Description
  Group: SrcInfo
  Data: electronic resource
– Name: Language
  Label: Language
  Group: Lang
  Data: English
– Name: ISSN
  Label: ISSN
  Group: ISSN
  Data: 1750-9378
– Name: NoteTitleSource
  Label: Relation
  Group: SrcInfo
  Data: https://doaj.org/toc/1750-9378
– Name: DOI
  Label: DOI
  Group: ID
  Data: 10.1186/s13027-020-00342-3
– Name: URL
  Label: Access URL
  Group: URL
  Data: <link linkTarget="URL" linkTerm="https://doaj.org/article/d550ee448cf644c49aefe8ea20ffdcc5" linkWindow="_blank">https://doaj.org/article/d550ee448cf644c49aefe8ea20ffdcc5</link>
– Name: AN
  Label: Accession Number
  Group: ID
  Data: edsdoj.550ee448cf644c49aefe8ea20ffdcc5
PLink https://login.libproxy.scu.edu/login?url=https://search.ebscohost.com/login.aspx?direct=true&site=eds-live&scope=site&db=edsdoj&AN=edsdoj.550ee448cf644c49aefe8ea20ffdcc5
RecordInfo BibRecord:
  BibEntity:
    Identifiers:
      – Type: doi
        Value: 10.1186/s13027-020-00342-3
    Languages:
      – Text: English
    PhysicalDescription:
      Pagination:
        PageCount: 9
        StartPage: 1
    Subjects:
      – SubjectFull: Killian polyp
        Type: general
      – SubjectFull: Human papillomavirus
        Type: general
      – SubjectFull: Polyomavirus
        Type: general
      – SubjectFull: Infection
        Type: general
      – SubjectFull: Nasal polyps
        Type: general
      – SubjectFull: Neoplasms. Tumors. Oncology. Including cancer and carcinogens
        Type: general
      – SubjectFull: RC254-282
        Type: general
      – SubjectFull: Infectious and parasitic diseases
        Type: general
      – SubjectFull: RC109-216
        Type: general
    Titles:
      – TitleFull: Association between oncogenic human papillomavirus type 16 and Killian polyp
        Type: main
  BibRelationships:
    HasContributorRelationships:
      – PersonEntity:
          Name:
            NameFull: Lucia Oton-Gonzalez
      – PersonEntity:
          Name:
            NameFull: John Charles Rotondo
      – PersonEntity:
          Name:
            NameFull: Luca Cerritelli
      – PersonEntity:
          Name:
            NameFull: Nicola Malagutti
      – PersonEntity:
          Name:
            NameFull: Carmen Lanzillotti
      – PersonEntity:
          Name:
            NameFull: Ilaria Bononi
      – PersonEntity:
          Name:
            NameFull: Andrea Ciorba
      – PersonEntity:
          Name:
            NameFull: Chiara Bianchini
      – PersonEntity:
          Name:
            NameFull: Chiara Mazziotta
      – PersonEntity:
          Name:
            NameFull: Monica De Mattei
      – PersonEntity:
          Name:
            NameFull: Stefano Pelucchi
      – PersonEntity:
          Name:
            NameFull: Mauro Tognon
      – PersonEntity:
          Name:
            NameFull: Fernanda Martini
    IsPartOfRelationships:
      – BibEntity:
          Dates:
            – D: 01
              M: 01
              Type: published
              Y: 2021
          Identifiers:
            – Type: issn-print
              Value: 17509378
          Numbering:
            – Type: volume
              Value: 16
            – Type: issue
              Value: 1
          Titles:
            – TitleFull: Infectious Agents and Cancer
              Type: main
ResultId 1