Academic Journal
View in EDS
PDF Full Text
HTML Full Text

Genetic alterations in anaplastic thyroid carcinoma

Bibliographic Details
Title: Genetic alterations in anaplastic thyroid carcinoma
Authors: M Rashid, Amit Agarwal, Roma Pradhan, Nelson George, Niraj Kumari, M Sabaretnam, Gyan Chand, Anjali Mishra, Gaurav Agarwal, Saroj Kanta Mishra
Source: Indian Journal of Endocrinology and Metabolism, Vol 23, Iss 4, Pp 480-485 (2019)
Publisher Information: Wolters Kluwer Medknow Publications, 2019.
Publication Year: 2019
Collection: LCC:Diseases of the endocrine glands. Clinical endocrinology
LCC:Diseases of the digestive system. Gastroenterology
Subject Terms: Anaplastic, genetic alteration, thyroid, Diseases of the endocrine glands. Clinical endocrinology, RC648-665, Diseases of the digestive system. Gastroenterology, RC799-869
More Details: Introduction: Anaplastic thyroid cancer (ATC) is rare but fatal thyroid cancer responsible for majority of thyroid cancer related mortality. ATC may originate de novo or from preexisting differentiated thyroid cancer. Complex interaction between different gene mutation has been suggested to be the main causative factor for origin of ATC in both pathways. Mostly affected pathways are MAP kinase and PI3CA kinase. Hence, we decided to study the frequent alterations in both the pathways in ATC patients. Methodology: Clinico-pathological data of 34 ATC patients were collected retrospectively and Formalin Fixed Paraffin Embedded (FFPE) blocks were taken out for genetic analysis. DNA and RANA were isolated from FFPE tissues. BRAF V600E mutations were screened by RFLP PCR method and confirmed by sequencing. RAS, PI3CA and p53 mutations were checked by sequencing. RET/PTC translocations were screened by Real Time PCR. Results: A total of 34 patients were studied: Mean age 58.6+ 11.6 years with F:M- 1.8:1, 60% had history of goiter. Most common presenting symptom was rapidly growing thyroid mass followed by dyspnea, dysphasia and hoarseness of voice. Extent of disease was local, locoregional and metastatic in 32%, 35% and 33% respectively. 57.6% were euthyroid, 20.5 % were hyperthyroid while functional status were not available in 11.7%. FNAC was suggestive of ATC only in 52.9% cases. 15 (44%) were operated. BRAF V600E mutations were observed in 10/34 (29.4%). Interestingly, all three ATC patients with DTC components had previous history of goiter with rapid increase in size and BRAF V600E mutation, while BRAF was positive only in 7/31 (22.5%) of patients with no DTC component. Mean survival of 3.5 months in BRAF positive cases in comparison to 5.5 months in BRAF negative ATC. RAS mutations were found to be positive in 5.8%, and none had RET-PTC/PI3CA mutations. P53 mutation was positive in 7 patients. 3 patients presented with history of rapid increase in size of previous goiter while rest 4 patients presented with rapidly increasing thyroid swelling of 1 to 3 months. At presentation 2 patients has disease localized to thyroid, 4 has loco-regional disease and one patient presented with metastasis. 5 out of these 7 patients were operated (Total thyroidectomy:3, thyroidectomy with neck dissection:2). Mean survival was 4 months (1-6 months). Conclusion: BRAF V600E was the commonest mutation followed by p53 of the 5 genes tested and BRAF was more common in patients with previous history of longstanding goiter or differentiated thyroid cancer. This provides an indirect evidence of neoplastic transformation of PTC to ATC.
Document Type: article
File Description: electronic resource
Language: English
ISSN: 2230-8210
Relation: http://www.ijem.in/article.asp?issn=2230-8210;year=2019;volume=23;issue=4;spage=480;epage=485;aulast=Rashid; https://doaj.org/toc/2230-8210
DOI: 10.4103/ijem.IJEM_321_19
Access URL: https://doaj.org/article/22351ce21eab4d009c9a0c3a3eb93070
Accession Number: edsdoj.22351ce21eab4d009c9a0c3a3eb93070
Database: Directory of Open Access Journals
Full text is not displayed to guests.
FullText Links:
  – Type: pdflink
    Url: https://content.ebscohost.com/cds/retrieve?content=AQICAHjPtM4BHU3ZchRwgzYmadcigk49r9CVlbU7V5F6lgH7WwGx-MuXY-P3BCQFKHu5rX58AAAA4jCB3wYJKoZIhvcNAQcGoIHRMIHOAgEAMIHIBgkqhkiG9w0BBwEwHgYJYIZIAWUDBAEuMBEEDLbFYgnPhFhevnZmfgIBEICBmnVJcoixpdynvbsaPZaczyhDxgRnzOjSt7d3HWjwSkQskjDGoVKx00ce4xr737yPVsHG97upX_nbY9zkwC1yFkfra9__1D8vEvIDZW60Be-rOkhC1AqVSo-Q8iazkwMLEOF_gng-uMP4rvTKxuHElBxkJx1pJ08Q7-85FVdf8DPGAGXdrBVuV-BZrEfK9Ac06IkpKpRPwK_4tiM=
Text:
  Availability: 1
  Value: <anid>AN0139121573;[bgdc]01jul.19;2019Oct16.05:00;v2.2.500</anid> <title id="AN0139121573-1">Genetic alterations in anaplastic thyroid carcinoma </title> <p>Introduction: Anaplastic thyroid cancer (ATC) is rare but fatal thyroid cancer responsible for majority of thyroid cancer related mortality. ATC may originate de novo or from preexisting differentiated thyroid cancer. Complex interaction between different gene mutation has been suggested to be the main causative factor for origin of ATC in both pathways. Mostly affected pathways are MAP kinase and PI3CA kinase. Hence, we decided to study the frequent alterations in both the pathways in ATC patients. Methodology: Clinico-pathological data of 34 ATC patients were collected retrospectively and Formalin Fixed Paraffin Embedded (FFPE) blocks were taken out for genetic analysis. DNA and RANA were isolated from FFPE tissues. BRAF V600E mutations were screened by RFLP PCR method and confirmed by sequencing. RAS, PI3CA and p53 mutations were checked by sequencing. RET/PTC translocations were screened by Real Time PCR. Results: A total of 34 patients were studied: Mean age 58.6+ 11.6 years with F:M- 1.8:1, 60% had history of goiter. Most common presenting symptom was rapidly growing thyroid mass followed by dyspnea, dysphasia and hoarseness of voice. Extent of disease was local, locoregional and metastatic in 32%, 35% and 33% respectively. 57.6% were euthyroid, 20.5 % were hyperthyroid while functional status were not available in 11.7%. FNAC was suggestive of ATC only in 52.9% cases. 15 (44%) were operated. BRAF V600E mutations were observed in 10/34 (29.4%). Interestingly, all three ATC patients with DTC components had previous history of goiter with rapid increase in size and BRAF V600E mutation, while BRAF was positive only in 7/31 (22.5%) of patients with no DTC component. Mean survival of 3.5 months in BRAF positive cases in comparison to 5.5 months in BRAF negative ATC. RAS mutations were found to be positive in 5.8%, and none had RET-PTC/PI3CA mutations. P53 mutation was positive in 7 patients. 3 patients presented with history of rapid increase in size of previous goiter while rest 4 patients presented with rapidly increasing thyroid swelling of 1 to 3 months. At presentation 2 patients has disease localized to thyroid, 4 has loco-regional disease and one patient presented with metastasis. 5 out of these 7 patients were operated (Total thyroidectomy:3, thyroidectomy with neck dissection:2). Mean survival was 4 months (1-6 months). Conclusion: BRAF V600E was the commonest mutation followed by p53 of the 5 genes tested and BRAF was more common in patients with previous history of longstanding goiter or differentiated thyroid cancer. This provides an indirect evidence of neoplastic transformation of PTC to ATC.</p> <p>Keywords: Anaplastic; genetic alteration; thyroid</p> <p>Introduction</p> <p>Thyroid cancer is the most prevalent endocrine malignancy accounting for 1% of cancers worldwide. More than 95% of thyroid cancer are well differentiated tumors that respond to surgery followed by radioactive iodine (RAI) therapy and thyroid hormone suppression. Anaplastic thyroid cancer constitutes <2% of thyroid cancers but carries almost 100% mortality.[[<reflink idref="bib1" id="ref1">1</reflink>]],[[<reflink idref="bib2" id="ref2">2</reflink>]]</p> <p>ATCs originate from follicular cells and may either derive <emph>de novo</emph> or from pre-existing well differentiated thyroid cancers (WDTCs) such as papillary thyroid carcinomas (PTCs), follicular thyroid carcinomas (FTCs) or even from poorly-differentiated thyroid carcinomas (PDTCs) by accumulation of various genetic alterations.[[<reflink idref="bib3" id="ref3">3</reflink>]],[[<reflink idref="bib4" id="ref4">4</reflink>]],[[<reflink idref="bib5" id="ref5">5</reflink>]],[[<reflink idref="bib6" id="ref6">6</reflink>]],[[<reflink idref="bib7" id="ref7">7</reflink>]],[[<reflink idref="bib8" id="ref8">8</reflink>]] Numerous studies have explored ATC mutational landscape and have increased our understanding of the molecular pathogenesis of thyroid cancer. Among the genetic alterations involved in thyroid tumourigenesis, <emph>BRAF</emph> mutations, <emph>RAS</emph> mutations and <emph>RET</emph> rearrangements are important in differentiated thyroid carcinomas.</p> <p>The beneficial effect of BRAF inhibition in ATC with activating BRAF mutations has been recently reported.[[<reflink idref="bib9" id="ref9">9</reflink>]],[[<reflink idref="bib10" id="ref10">10</reflink>]] Other genetic alterations include gain of function mutations in the PIK3CA gene, mutations in the CTNNB1, loss of function alterations of tumor suppression genes such as PTEN, and mutation or inactivation of P53 gene. Hence the knowledge of the tumor mutation status is needed for optimizing and tailoring the treatment with kinase inhibitors as well as in understanding the heterogeneity and failure of existing treatment approaches.[[<reflink idref="bib9" id="ref11">9</reflink>]],[[<reflink idref="bib11" id="ref12">11</reflink>]] We sought to study the genetic alterations in ATC with the aim of finding out whether there is any difference in mutations in those ATC which are thought to develop from a pre-existing DTC as compared to those develop de-novo and to look for any clinco-pathological correlation with a particular mutation/inactivation.</p> <p>Methods</p> <p>Sample Collection</p> <p>Study was conducted at department of endocrine surgery, SGPGI. Data of all patients diagnosed with anaplastic thyroid carcinoma from 1990 to 2018 were collected and 34 patients with a complete clinicopathological record and adequate tissue samples for genetic analysis were selected for the study. The cases with incomplete records and with poor tissue samples were excluded from the study. Formalin Fixed Paraffin Embedded (FFPE) blocks were taken out for genetic analysis. The study was approved by Institutional Ethics committee. Institute ethics committee: JAN 2017. Ethics number 2017-3-IMP-95.</p> <p>Methods of gene analysis</p> <p> <emph>DNA isolation</emph> </p> <p>The tumor areas were confirmed and marked from the slides stained by Heamatoxylin and eosin stain (H and E stain). Eight sections of 10 micron from each FFPE tissue blocks were subjected to DNA extraction using QIAamp FFPE tissue kit (Qiagen, Germany). The quality and quantity of the DNA was measured by using the Nano Drop 2000c (Thermo Fisher Scientific, US).</p> <p> <emph>RNA isolation</emph> </p> <p>Total RNA was isolated from 34 FFPE ATC tissues by using Recover All Total Nucleic Acid isolation kit for FFPE (Thermo Fisher Scientific, US). Quantity and quality were measured by Nano Drop 2000c (Thermo Fisher Scientific, US and stored in -80°C). Yield and quality of RNA was not affected by the procedure and storage. Further cDNA was synthesized by using Revert Aid First strand cDNA synthesis kit (Thermo Fisher Scientific, US).</p> <p>Point mutation analysis</p> <p>The presence of <emph>BRAF V600E and K601E, NRAS codon 61, HRAS codon 61,</emph> and <emph>KRAS codons 12 and 13</emph> point mutations was analyzed using two different techniques.</p> <p>PCR-RFLP and sequencing for BRAF</p> <p>The most common BRAF V600E mutation reported in thyroid carcinomas is confined to exon 15. We therefore amplified BRAF exon 15 by polymerase chain reaction (PCR) using the following primers: forward '5GCTTGCTCTGATAGGAAAATGAG3'; reverse '5GATACTCAGCAGCATCTCAGG3'. The denatured PCR products were electrophoresed [Figure 1]a and digestion of the 237-base pair (bp) PCR fragment with restriction endonuclease TspRI showed 3 major bands of 117 bp, 87 bp, and 33 bp for the wild type allele [Figure 1]b. The T1799A mutation abolished the restriction sites, which resulted in a prominent band of 237 bp from the mutant allele and residual bands from the normal allele.[[<reflink idref="bib12" id="ref13">12</reflink>]] Randomly selected three BRAF positive samples were sequenced [Figure 1]c using Applied Biosystems 3500 genetic analyzer and reconfirmed the presence of BRAF mutations.{Figure 1}</p> <p>RET/PTC rearrangements: RET/PTC1, RET/PTC3, rearrangements was detected from RNA by RTPCR with primers designed to flank the respective fusion point. Quality of RNA in each sample was assessed by amplification of the -GAPDH gene. Primers and Taqman probe for RET/PTC1 were used as described previously in detail.[[<reflink idref="bib12" id="ref14">12</reflink>]]</p> <p>RAS and PI3CA mutation detection</p> <p>Point mutations in codons 12/13 of the H-RAS, K-RAS and codon 61 of N-RAS genes were analyzed by Sanger sequencing method [Figure 2]. DNA isolated from the FFPE tissue was amplified for KRAS, HRAS and NRAS using the following PCR primers: codon 12/13 KRAS-A (5′-GGCCTGCTGAAAATGACTGA-3′) and D (5′-TAGCTGTATCGTCAAGGCAC-3′), codon 12/13 of HRAS 5′-TGAGGAGCGATGACGGAA-3′ and 5′-GCGCTAGGCTCACCTCTAT-3′, codon 61 NRAS: 5′-CCTGTTTGTTGGACATACTG-3 and 5′-CCTGTAGAGGTTAATATC CG-3′.{Figure 2}</p> <p>Using specific primers (exon 9 forward, 5′-ATCATCTGTGAATCCAGA-3′; exon 9 reverse, 5′-TTAGCACTTACCTGTGAC-3′; exon 20 forward, 5′-TGACATTTGAGCAAAGACC-3′; and exon 20 reverse, 5′-GTGTGGAATCCAGAGTGA-3′), the portions of exon 9 and 20 of PI3K gene were amplified. Further, these portions were sequenced using ABI capillary sequencer.</p> <p>P53 IHC</p> <p>The sections were cut at 4μ thickness on polylysine coated slides, deparaffinised and rehydrated in graded alcohols. Antigen retrieval was done in EDTA buffer at pH 8.9 followed by endogenous peroxidase blocking with 3% H<subs>2</subs>O<subs>2</subs>. Sections with primary monoclonal antibody for P53 (dilution - 1:200, source <emph>P</emph> 53 polyclonal antibody from Cell Signaling Technology, United States) were incubated for 1 hour at room temperature. Secondary antibody (UltraVision Quanto Detection System, Thermo Fisher) was incubated for 30 minutes at room temperature. Diaminobenzidine was used as chromogen and followed by counterstaining with Mayer's hematoxylin and mounting in DPX. Nuclear expression was considered as positive staining.</p> <p>Results</p> <p>A total of 34 patients were studied. Mean age was 58.6 ± 11.6 years. Female:male ratio was 1.8:1 [Table 1]. 60% had history of previous goiter.{Table 1}</p> <p>Most common presenting symptom was rapidly growing thyroid mass followed by dyspnea, dysphasia and hoarseness of voice. The extent of disease was local, locoregional and metastatic in 32, 35 and 33% respectively [Table 2], [Table 3] and [Table 4]. 57.6% were euthyroid, 20.5% were hyperthyroid while functional status was not available in 4 patients. FNAC was suggestive of ATC only in 52.9% cases [Table 5]. 15 (44%) patients were operated [Table 6].{Table 2}{Table 3}{Table 4}{Table 5}{Table 6}</p> <p>BRAF V600E mutations were observed in 10/34 (29.4%). Interestingly, all three ATC patients with DTC components had previous history of goiter with rapid increase in size and BRAF V600E mutation, while BRAF was positive only in 7/31 (22.5%) of patients with no DTC component. Mean survival of 3.5 months in BRAF positive cases in comparison to 5.5 months in BRAF negative ATC. RAS mutations were found to be positive in 5.8%, and none had RET-PTC/PI3CA mutations. P53 mutation was positive in 7 patients. 3 patients presented with history of rapid increase in size of previous goiter while rest 4 patients presented with rapidly increasing thyroid swelling of 1 to 3 months [Table 7]. At presentation 2 patients has disease localized to thyroid, 4 has loco-regional disease and one patient presented with metastasis. 5 out of these 7 patients were operated (Total thyroidectomy: 3, thyroidectomy with neck dissection: 2). Mean survival was 4 months (1-6 months). There were no concomitant mutations present however, immunohistochemistry of P53 was positive in 3 BRAF mutated cases (3/7) and one RAS positive patient (1/7) [Figure 3].{Table 7}{Figure 3}</p> <p>Discussion</p> <p>Anaplastic thyroid cancer has poor survival despite aggressive conventional therapy. Ina previous publication from the authors[[<reflink idref="bib13" id="ref15">13</reflink>]] mean survival in a series of 100 patients was only 3 months. It is still therefore a "viper in the thyroid cancer pit."[[<reflink idref="bib14" id="ref16">14</reflink>]] Thus there is a need to look beyond the conventional forms of treatment such as molecular therapy. Genetic alterations are highly prevalent in anaplastic thyroid cancer in comparison to differentiated thyroid cancer. Zhi Liu[[<reflink idref="bib15" id="ref17">15</reflink>]]<emph>et al</emph>. has shown that overall, 46 of 48 ATC (95.8%) harboured at least one genetic alteration either in MAP kinase pathway or PIK3/Akt pathway. In our study overall 21 of 34 (67%) patients tested positive for at least one mutation. BRAF V600E mutations were observed in 10/34 (29.4%). It was the most common mutation in our study.</p> <p>BRAF mutation has been documented to be the most common mutation in papillary thyroid cancer.[[<reflink idref="bib16" id="ref18">16</reflink>]],[[<reflink idref="bib17" id="ref19">17</reflink>]] The high prevalence of BRAFV600E mutation in ATC supports the hypothesis that many ATCs actually represent a progressive malignant degeneration of BRAF-mutated, well-differentiated thyroid carcinomas.[[<reflink idref="bib18" id="ref20">18</reflink>]] This gene is a pivotal component of the MAPK pathway and reduces the activity of p21kip1 in thyroid tumors, stimulating the cell cycle machinery. Although clinical studies of BRAF inhibitors in advanced non RAI-responsive differentiated thyroid carcinomas have shown encouraging results with frequent early responses, in a relevant fraction of patients this effect was of limited duration, with frequent relapse or no response. Interestingly, all three ATC patients with DTC components had previous history of goiter with rapid increase in size and BRAF V600E mutation, which again support the hypothesis of origin of ATC from progressive degeneration of differentiated thyroid cancer.</p> <p>The high prevalence of BRAFV600E mutation in ATC supports the hypothesis that many ATCs actually represent a progressive malignant degeneration of BRAF-mutated, well-differentiated thyroid carcinomas.[[<reflink idref="bib18" id="ref21">18</reflink>]] In our study, BRAF mutations were found in 29.4% of cases. All mutations were p.V600E and were mutually exclusive to (K-H-N)-RAS mutation. Despite a well-known correlation between the presence of a BRAF mutation and tumor aggressiveness in PTCs,[[<reflink idref="bib19" id="ref22">19</reflink>]],[[<reflink idref="bib20" id="ref23">20</reflink>]] BRAF mutations are less frequent in ATCs (as in our cohort) than in PTCs (prevalence of 45-50%).[[<reflink idref="bib21" id="ref24">21</reflink>]],[[<reflink idref="bib22" id="ref25">22</reflink>]]</p> <p>Since BRAF mutations do not appear to occur during tumor dedifferentiation but are relatively early and frequent events in PTC carcinogenesis,[[<reflink idref="bib23" id="ref26">23</reflink>]] all ATCs may not be derived from PTCs. Therefore BRAF mutations seem to most prevalent mutation in PDTC.[[<reflink idref="bib24" id="ref27">24</reflink>]] BRAF-mutant cells have been reported to be MEK dependent and selectively more sensitive to MEK inhibition than either RAS-mutant or both BRAF and RAS wild-type cells. As MEK is a key downstream signaling mediator of the MAP-kinase pathway, the use of co-inhibitors has been proposed in anticancer therapies.[[<reflink idref="bib25" id="ref28">25</reflink>]]</p> <p>An obstacle to the efficacy of treatments based on the inhibition of BRAF V600E is the presence of activating mutations of RAS. This proto-oncogene is located upstream RAF in the MAPK cascade. Activating mutations of this protein reactivate the MAPK pathway, making BRAFV600E inhibition inefficient.[[<reflink idref="bib18" id="ref29">18</reflink>]] The high prevalence of RAS activating mutations in ATC (60%) makes the inhibition of the MAPK pathway by kinase inhibitors unsuccessful. Moreover, papillary thyroid carcinoma and ATC exhibit concomitant BRAFV600E and RAS mutations, although a rare occurrence.[[<reflink idref="bib19" id="ref30">19</reflink>]],[[<reflink idref="bib20" id="ref31">20</reflink>]] In light of these considerations, the pharmacological inhibition of the MAPK pathway looks less promising than the inhibition of the PI3K/Akt/mTOR pathway.</p> <p>P53 was second most common mutation in our study found in 7 of 34 (20.5%) patients. This mutation has been suggested to be associated with <emph>de novo</emph> origin of anaplastic thyroid cancer. In contrast to our study in which BRAF was the most common mutation, few other studies suggest that p53 is the most common mutation in anaplastic thyroid cancer.[[<reflink idref="bib21" id="ref32">21</reflink>]] The prevalence rate in the literature ranges from 48%[[<reflink idref="bib24" id="ref33">24</reflink>]] to up to 70-80%.[[<reflink idref="bib26" id="ref34">26</reflink>]],[[<reflink idref="bib27" id="ref35">27</reflink>]] It has been suggested that wild type p53 gene helps in expression of sodium iodide symporter I thyroid follicular cells allowing radioiodine therapy. Inactivating mutation in p53 leads to loss of sodium iodide symporter and radio-iodine avidity, thereby resulting in poor prognosis[[<reflink idref="bib28" id="ref36">28</reflink>]] In our study P53 mutation was positive in 7 patients. 3 of 7 patients presented with history of rapid increase in size of previous goiter while rest 4 patients presented with rapidly increasing thyroid swelling of 1 to 3 months. At presentation, 2 patients has disease localized to thyroid, 4 had loco-regional disease and one patient presented with metastases. Mean survival of these 7 patients was 4 months.</p> <p>Incidence of RAS mutation is relatively low in anaplastic thyroid cancer. These mutations are frequent in a variety of thyroid tumors from benign follicular adenomas (20-25%) to aggressive ATCs (20-30%) indicating a role in early tumorigenesis.[[<reflink idref="bib29" id="ref37">29</reflink>]] It was found to be positive in 5.8% of our cases. Libero Santarpia <emph>et al</emph>. in 2008[[<reflink idref="bib30" id="ref38">30</reflink>]] studied 36 samples of ATCs and found RAS mutation in 6% of cases which is close to that of our study. On the other hand, RAS mutations are the commonest molecular alteration in poorly differentiated carcinoma.[[<reflink idref="bib31" id="ref39">31</reflink>]] RAS mutation has not been shown to be associated with overall prognosis in ATC.</p> <p>The prevalence of PIK3/AKT pathway alteration in our series was much lower than that reported in the literature for ATCs (15-25%) and close to that found for follicular carcinomas.[[<reflink idref="bib18" id="ref40">18</reflink>]] It is suggested that PIK3CA alterations often cooperate with other Oncogenic events.[[<reflink idref="bib32" id="ref41">32</reflink>]]</p> <p>Although RET/PTC rearrangement is a common mutation in papillary thyroid cancer, it is not common in anaplastic thyroid cancer. We analyzed all 3 types of RET/PTC rearrangement in 34 samples. None of the samples tested positive for RET/PTC rearrangement. A single RET mutation has been identified in a series of 22 ATCs,[[<reflink idref="bib33" id="ref42">33</reflink>]] associated with TP53, CTNNB1 and RASAL1 mutations Roderick M. <emph>et al</emph>.[[<reflink idref="bib34" id="ref43">34</reflink>]] analyzed RET/PTC rearrangement in 8 ATC tumor samples and did not find any sample positive.</p> <p>Conclusion</p> <p>BRAF mutation is responsible for majority of ATC originating from or in combination of differentiated thyroid cancer. This provide and indirect evidence of origin of ATC from preexisting DTC. BRAF positive ATC has poor survival than those of BRAF negative cases.</p> <p>Financial support and sponsorship</p> <p>Nil.</p> <p>Conflicts of interest</p> <p>There are no conflicts of interest.</p> <ref id="AN0139121573-2"> <title> REFERENCES </title> <blist> <bibl id="bib1" idref="ref1" type="bt">1</bibl> <bibtext> Hundahl SA, Fleming ID, Fremgen AM, Menck HR. A national cancer data base report on 53,856 cases of thyroid carcinoma treated in the U.S., 1985–1995. Cancer 1998;83:2638-48.</bibtext> </blist> <blist> <bibl id="bib2" idref="ref2" type="bt">2</bibl> <bibtext> Kitamura Y, Shimizu K, Nagahama M, Sugino K, Ozaki O, Mimura T, et al. Immediate causes of death in thyroid carcinoma: Clinicopathological analysis of 161 fatal cases. J Clin Endocrinol Metab 1999;84:4043-9.</bibtext> </blist> <blist> <bibl id="bib3" idref="ref3" type="bt">3</bibl> <bibtext> Venkatesh YS, Ordonez NG, Schultz PN, Hickey RC, Goepfert H, Samaan NA. Anaplastic carcinoma of the thyroid. A clinicopathologic study of 121 cases. Cancer 1990;66:321-30.</bibtext> </blist> <blist> <bibl id="bib4" idref="ref4" type="bt">4</bibl> <bibtext> Smallridge RC, Ain KB, Asa SL, Bible KC, Brierley JD, Burman KD, et al. American thyroid association guidelines for management of patients with anaplastic thyroid cancer. Thyroid Off J Am Thyroid Assoc 2012;22:1104-39.</bibtext> </blist> <blist> <bibl id="bib5" idref="ref5" type="bt">5</bibl> <bibtext> McIver B, Hay ID, Giuffrida DF, Dvorak CE, Grant CS, Thompson GB, et al. Anaplastic thyroid carcinoma: A 50-year experience at a single institution. Surgery 2001;130:1028-34.</bibtext> </blist> <blist> <bibl id="bib6" idref="ref6" type="bt">6</bibl> <bibtext> Lam KY, Lo CY, Chan KW, Wan KY. Insular and anaplastic carcinoma of the thyroid: A 45- year comparative study at a single institution and a review of the significance of p53 and p21. Ann Surg 2000;231:329-38.</bibtext> </blist> <blist> <bibl id="bib7" idref="ref7" type="bt">7</bibl> <bibtext> Cornett WR, Sharma AK, Day TA, Richardson MS, Hoda RS, van Heerden JA, et al. Anaplastic thyroid carcinoma: An overview. Curr Oncol Rep 2007;9:152-8.</bibtext> </blist> <blist> <bibl id="bib8" idref="ref8" type="bt">8</bibl> <bibtext> DeLellis RA. Pathology and Genetics of Tumours of Endocrine Organs (World Health Organization Classification of Tumours). Lyon: IARC Press; 2004.</bibtext> </blist> <blist> <bibl id="bib9" idref="ref9" type="bt">9</bibl> <bibtext> Rosove MH, Peddi PF, Glaspy JA. BRAF V600E inhibition in anaplastic thyroid cancer. N Engl J Med 2013;368:684-5.</bibtext> </blist> <blist> <bibtext> Marten KA, Gudena VK. Use of vemurafenib in anaplastic thyroid carcinoma: A case report. Cancer Biol Ther 2015;16:1430-3.</bibtext> </blist> <blist> <bibtext> Guerra A, Di Crescenzo V, Garzi A, Cinelli M, Carlomagno C, Tonacchera M. et al. Genetic mutations in the treatment of anaplastic thyroid cancer. BMC Surg 2013;13:44.</bibtext> </blist> <blist> <bibtext> Nikiforova MN, Nikiforov YE. Molecular diagnostics and predictors in thyroid cancer. Thyroid 2009;19:1351-61.</bibtext> </blist> <blist> <bibtext> Pradhan R, Agarwal A, Lal P, Kumari N, Jain M, Chand G, et al. Clinico-pathological profile of anaplastic thyroid carcinoma in an endemic goiter area. Indian J Endocrinol Metab 2018;22:793-7.</bibtext> </blist> <blist> <bibtext> Seshadri KG. Anaplastic cancer of the thyroid: The viper in the pit. Indian J Endocrinol Metab 2019;23:1-2.</bibtext> </blist> <blist> <bibtext> Liu Z, Hou P, Ji M, Guan H, Studeman K, Jensen K, et al. Highly prevalent genetic alterations in receptor tyrosine kinases and phosphatidylinositol 3-kinase/akt and mitogen-activated protein kinase pathways in anaplastic and follicular thyroid cancers. J Clin Endocrinol Metab 2008;93:3106-16.</bibtext> </blist> <blist> <bibtext> Cohen Y, Xing M, Mambo E, Guo Z, Wu G, Trink B, et al. BRAF mutation in papillary thyroid carcinoma. J Natl Cancer Inst 2003;95:625-7.</bibtext> </blist> <blist> <bibtext> Kimura ET, Nikiforova MN, Zhu Z, Knauf JA, Nikiforov YE, Fagin JA. High prevalence of BRAF mutations in thyroid cancer: Genetic evidence for constitutive activation of the RET/PTC-RAS-BRAF signaling pathway in papillary thyroid carcinoma. Cancer Res 2003;63:1454-7.</bibtext> </blist> <blist> <bibtext> Xing M. Molecular pathogenesis and mechanisms of thyroid cancer. Nat Rev Cancer 2013;13:184-99.</bibtext> </blist> <blist> <bibtext> Xing M. BRAF mutation in papillary thyroid cancer: Pathogenic role, molecular bases, and clinical implications. Endocr Rev 2007;28:742-62.</bibtext> </blist> <blist> <bibtext> Xing M, Westra WH, Tufano RP, Cohen Y, Rosenbaum E, Rhoden KJ, et al. BRAF mutation predicts a poorer clinical prognosis for papillary thyroid cancer. J Clin Endocrinol Metab 2005;90:6373-9.</bibtext> </blist> <blist> <bibtext> Kondo T, Ezzat S, Asa SL. Pathogenetic mechanisms in thyroid follicular-cell neoplasia. Nat Rev Cancer 2006;6:292-306.</bibtext> </blist> <blist> <bibtext> George N, Agarwal A, Kumari N, Agarwal S, Krisnani N, Gupta SK. Mutational profile of papillary thyroid carcinoma in an endemic goiter region of North India. Indian J Endocrinol Metab 2018;22:505-10.</bibtext> </blist> <blist> <bibtext> Begum S, Rosenbaum E, Henrique R, Cohen Y, Sidransky D, Westra WH. BRAF mutations in anaplastic thyroid carcinoma: Implications for tumor origin, diagnosis and treatment. Mod Pathol 2004;17:1359-63.</bibtext> </blist> <blist> <bibtext> Hiltzik D, Carlson DL, Tuttle RM, Chuai S, Ishill N, Shaha A, et al. Poorly differentiated thyroid carcinomas defined on the basis of mitosis and necrosis: A clinicopathologic study of 58 patients. Cancer 2006;106:1286-95.</bibtext> </blist> <blist> <bibtext> Catalanotti F, Solit DB, Pulitzer MP, Berger MF, Scott SN, Iyriboz T, et al. Phase II trial of MEK inhibitor selumetinib (AZD6244, ARRY-142886) in patients with BRAFV600E/K-mutated melanoma. Clin Cancer Res 2013;19:2257-64.</bibtext> </blist> <blist> <bibtext> Fagin JA, Matsuo K, Karmakar A, Chen DL, Tang SH, Koeffler HP. High prevalence of mutations of the p53 gene in poorly differentiated human thyroid carcinomas. J Clin Invest 1993;91:179-84.</bibtext> </blist> <blist> <bibtext> Donghi R, Longoni A, Pilotti S, Michieli P, Della Porta G, Pierotti MA. Gene p53 mutations are restricted to poorly differentiated and undifferentiated carcinomas of the thyroid gland. J Clin Invest 1993;91:1753-60.</bibtext> </blist> <blist> <bibtext> Liu L, Li D, Chen Z, Yang J, Ma Y, Cai H, et al. Wild-Type P53 induces sodium/iodide symporter expression allowing radioiodide therapy in anaplastic thyroid cancer. Cell Physiol Biochem 2017;43:905-14.</bibtext> </blist> <blist> <bibtext> Wiseman SM, Griffith OL, Gown A, Walker B, Jones SJM. Immunophenotyping of thyroid tumors identifies molecular markers altered during transformation of differentiated into anaplastic carcinoma. Am J Surg 2011;201:580-6.</bibtext> </blist> <blist> <bibtext> Santarpia L, El-Naggar AK, Cote GJ, Myers JN, Sherman SI. Phosphatidylinositol 3-kinase/akt and ras/raf-mitogen-activated protein kinase pathway mutations in anaplastic thyroid cancer. J Clin Endocrinol Metab 2008;93:278-84.</bibtext> </blist> <blist> <bibtext> Volante M, Collini P, Nikiforov YE, Sakamoto A, Kakudo K, Katoh R, et al. Poorly differentiated thyroid carcinoma: The turin proposal for the use of uniform diagnostic criteria and an algorithmic diagnostic approach. Am J Surg Pathol 2007;31:1256-64.</bibtext> </blist> <blist> <bibtext> Abubaker J, Jehan Z, Bavi P, Sultana M, Al-Harbi S, Ibrahim M, et al. Clinicopathological analysis of papillary thyroid cancer with PIK3CA alterations in a Middle Eastern population. J Clin Endocrinol Metab 2008;93:611-8.</bibtext> </blist> <blist> <bibtext> Kunstman JW, Juhlin CC, Goh G, Brown TC, Stenman A, Healy JM, et al. Characterization of the mutational landscape of anaplastic thyroid cancer via whole-exome sequencing. Hum Mol Genet 2015;24:2318-29.</bibtext> </blist> <blist> <bibtext> Quiros RM, Ding HG, Gattuso P, Prinz RA, Xu X. Evidence that one subset of anaplastic thyroid carcinomas are derived from papillary carcinomas due to BRAF and p53 mutations. Cancer 2005;103:2261-8.</bibtext> </blist> </ref> <aug> <p>By M Rashid; Amit Agarwal; Roma Pradhan; Nelson George; Niraj Kumari; M Sabaretnam; Gyan Chand; Anjali Mishra; Gaurav Agarwal and Saroj Mishra</p> <p>Reported by Author; Author; Author; Author; Author; Author; Author; Author; Author; Author</p> </aug> <nolink nlid="nl1" bibid="bib10" firstref="ref10"></nolink> <nolink nlid="nl2" bibid="bib11" firstref="ref12"></nolink> <nolink nlid="nl3" bibid="bib12" firstref="ref13"></nolink> <nolink nlid="nl4" bibid="bib13" firstref="ref15"></nolink> <nolink nlid="nl5" bibid="bib14" firstref="ref16"></nolink> <nolink nlid="nl6" bibid="bib15" firstref="ref17"></nolink> <nolink nlid="nl7" bibid="bib16" firstref="ref18"></nolink> <nolink nlid="nl8" bibid="bib17" firstref="ref19"></nolink> <nolink nlid="nl9" bibid="bib18" firstref="ref20"></nolink> <nolink nlid="nl10" bibid="bib19" firstref="ref22"></nolink> <nolink nlid="nl11" bibid="bib20" firstref="ref23"></nolink> <nolink nlid="nl12" bibid="bib21" firstref="ref24"></nolink> <nolink nlid="nl13" bibid="bib22" firstref="ref25"></nolink> <nolink nlid="nl14" bibid="bib23" firstref="ref26"></nolink> <nolink nlid="nl15" bibid="bib24" firstref="ref27"></nolink> <nolink nlid="nl16" bibid="bib25" firstref="ref28"></nolink> <nolink nlid="nl17" bibid="bib26" firstref="ref34"></nolink> <nolink nlid="nl18" bibid="bib27" firstref="ref35"></nolink> <nolink nlid="nl19" bibid="bib28" firstref="ref36"></nolink> <nolink nlid="nl20" bibid="bib29" firstref="ref37"></nolink> <nolink nlid="nl21" bibid="bib30" firstref="ref38"></nolink> <nolink nlid="nl22" bibid="bib31" firstref="ref39"></nolink> <nolink nlid="nl23" bibid="bib32" firstref="ref41"></nolink> <nolink nlid="nl24" bibid="bib33" firstref="ref42"></nolink> <nolink nlid="nl25" bibid="bib34" firstref="ref43"></nolink>
CustomLinks:
  – Url: https://resolver.ebsco.com/c/xy5jbn/result?sid=EBSCO:edsdoj&genre=article&issn=22308210&ISBN=&volume=23&issue=4&date=20190101&spage=480&pages=480-485&title=Indian Journal of Endocrinology and Metabolism&atitle=Genetic%20alterations%20in%20anaplastic%20thyroid%20carcinoma&aulast=M%20Rashid&id=DOI:10.4103/ijem.IJEM_321_19
    Name: Full Text Finder (for New FTF UI) (s8985755)
    Category: fullText
    Text: Find It @ SCU Libraries
    MouseOverText: Find It @ SCU Libraries
  – Url: https://doaj.org/article/22351ce21eab4d009c9a0c3a3eb93070
    Name: EDS - DOAJ (s8985755)
    Category: fullText
    Text: View record from DOAJ
    MouseOverText: View record from DOAJ
Header DbId: edsdoj
DbLabel: Directory of Open Access Journals
An: edsdoj.22351ce21eab4d009c9a0c3a3eb93070
RelevancyScore: 918
AccessLevel: 3
PubType: Academic Journal
PubTypeId: academicJournal
PreciseRelevancyScore: 917.664306640625
IllustrationInfo
Items – Name: Title
  Label: Title
  Group: Ti
  Data: Genetic alterations in anaplastic thyroid carcinoma
– Name: Author
  Label: Authors
  Group: Au
  Data: <searchLink fieldCode="AR" term="%22M+Rashid%22">M Rashid</searchLink><br /><searchLink fieldCode="AR" term="%22Amit+Agarwal%22">Amit Agarwal</searchLink><br /><searchLink fieldCode="AR" term="%22Roma+Pradhan%22">Roma Pradhan</searchLink><br /><searchLink fieldCode="AR" term="%22Nelson+George%22">Nelson George</searchLink><br /><searchLink fieldCode="AR" term="%22Niraj+Kumari%22">Niraj Kumari</searchLink><br /><searchLink fieldCode="AR" term="%22M+Sabaretnam%22">M Sabaretnam</searchLink><br /><searchLink fieldCode="AR" term="%22Gyan+Chand%22">Gyan Chand</searchLink><br /><searchLink fieldCode="AR" term="%22Anjali+Mishra%22">Anjali Mishra</searchLink><br /><searchLink fieldCode="AR" term="%22Gaurav+Agarwal%22">Gaurav Agarwal</searchLink><br /><searchLink fieldCode="AR" term="%22Saroj+Kanta+Mishra%22">Saroj Kanta Mishra</searchLink>
– Name: TitleSource
  Label: Source
  Group: Src
  Data: Indian Journal of Endocrinology and Metabolism, Vol 23, Iss 4, Pp 480-485 (2019)
– Name: Publisher
  Label: Publisher Information
  Group: PubInfo
  Data: Wolters Kluwer Medknow Publications, 2019.
– Name: DatePubCY
  Label: Publication Year
  Group: Date
  Data: 2019
– Name: Subset
  Label: Collection
  Group: HoldingsInfo
  Data: LCC:Diseases of the endocrine glands. Clinical endocrinology<br />LCC:Diseases of the digestive system. Gastroenterology
– Name: Subject
  Label: Subject Terms
  Group: Su
  Data: <searchLink fieldCode="DE" term="%22Anaplastic%22">Anaplastic</searchLink><br /><searchLink fieldCode="DE" term="%22genetic+alteration%22">genetic alteration</searchLink><br /><searchLink fieldCode="DE" term="%22thyroid%22">thyroid</searchLink><br /><searchLink fieldCode="DE" term="%22Diseases+of+the+endocrine+glands%2E+Clinical+endocrinology%22">Diseases of the endocrine glands. Clinical endocrinology</searchLink><br /><searchLink fieldCode="DE" term="%22RC648-665%22">RC648-665</searchLink><br /><searchLink fieldCode="DE" term="%22Diseases+of+the+digestive+system%2E+Gastroenterology%22">Diseases of the digestive system. Gastroenterology</searchLink><br /><searchLink fieldCode="DE" term="%22RC799-869%22">RC799-869</searchLink>
– Name: Abstract
  Label: Description
  Group: Ab
  Data: Introduction: Anaplastic thyroid cancer (ATC) is rare but fatal thyroid cancer responsible for majority of thyroid cancer related mortality. ATC may originate de novo or from preexisting differentiated thyroid cancer. Complex interaction between different gene mutation has been suggested to be the main causative factor for origin of ATC in both pathways. Mostly affected pathways are MAP kinase and PI3CA kinase. Hence, we decided to study the frequent alterations in both the pathways in ATC patients. Methodology: Clinico-pathological data of 34 ATC patients were collected retrospectively and Formalin Fixed Paraffin Embedded (FFPE) blocks were taken out for genetic analysis. DNA and RANA were isolated from FFPE tissues. BRAF V600E mutations were screened by RFLP PCR method and confirmed by sequencing. RAS, PI3CA and p53 mutations were checked by sequencing. RET/PTC translocations were screened by Real Time PCR. Results: A total of 34 patients were studied: Mean age 58.6+ 11.6 years with F:M- 1.8:1, 60% had history of goiter. Most common presenting symptom was rapidly growing thyroid mass followed by dyspnea, dysphasia and hoarseness of voice. Extent of disease was local, locoregional and metastatic in 32%, 35% and 33% respectively. 57.6% were euthyroid, 20.5 % were hyperthyroid while functional status were not available in 11.7%. FNAC was suggestive of ATC only in 52.9% cases. 15 (44%) were operated. BRAF V600E mutations were observed in 10/34 (29.4%). Interestingly, all three ATC patients with DTC components had previous history of goiter with rapid increase in size and BRAF V600E mutation, while BRAF was positive only in 7/31 (22.5%) of patients with no DTC component. Mean survival of 3.5 months in BRAF positive cases in comparison to 5.5 months in BRAF negative ATC. RAS mutations were found to be positive in 5.8%, and none had RET-PTC/PI3CA mutations. P53 mutation was positive in 7 patients. 3 patients presented with history of rapid increase in size of previous goiter while rest 4 patients presented with rapidly increasing thyroid swelling of 1 to 3 months. At presentation 2 patients has disease localized to thyroid, 4 has loco-regional disease and one patient presented with metastasis. 5 out of these 7 patients were operated (Total thyroidectomy:3, thyroidectomy with neck dissection:2). Mean survival was 4 months (1-6 months). Conclusion: BRAF V600E was the commonest mutation followed by p53 of the 5 genes tested and BRAF was more common in patients with previous history of longstanding goiter or differentiated thyroid cancer. This provides an indirect evidence of neoplastic transformation of PTC to ATC.
– Name: TypeDocument
  Label: Document Type
  Group: TypDoc
  Data: article
– Name: Format
  Label: File Description
  Group: SrcInfo
  Data: electronic resource
– Name: Language
  Label: Language
  Group: Lang
  Data: English
– Name: ISSN
  Label: ISSN
  Group: ISSN
  Data: 2230-8210
– Name: NoteTitleSource
  Label: Relation
  Group: SrcInfo
  Data: http://www.ijem.in/article.asp?issn=2230-8210;year=2019;volume=23;issue=4;spage=480;epage=485;aulast=Rashid; https://doaj.org/toc/2230-8210
– Name: DOI
  Label: DOI
  Group: ID
  Data: 10.4103/ijem.IJEM_321_19
– Name: URL
  Label: Access URL
  Group: URL
  Data: <link linkTarget="URL" linkTerm="https://doaj.org/article/22351ce21eab4d009c9a0c3a3eb93070" linkWindow="_blank">https://doaj.org/article/22351ce21eab4d009c9a0c3a3eb93070</link>
– Name: AN
  Label: Accession Number
  Group: ID
  Data: edsdoj.22351ce21eab4d009c9a0c3a3eb93070
PLink https://login.libproxy.scu.edu/login?url=https://search.ebscohost.com/login.aspx?direct=true&site=eds-live&scope=site&db=edsdoj&AN=edsdoj.22351ce21eab4d009c9a0c3a3eb93070
RecordInfo BibRecord:
  BibEntity:
    Identifiers:
      – Type: doi
        Value: 10.4103/ijem.IJEM_321_19
    Languages:
      – Text: English
    PhysicalDescription:
      Pagination:
        PageCount: 6
        StartPage: 480
    Subjects:
      – SubjectFull: Anaplastic
        Type: general
      – SubjectFull: genetic alteration
        Type: general
      – SubjectFull: thyroid
        Type: general
      – SubjectFull: Diseases of the endocrine glands. Clinical endocrinology
        Type: general
      – SubjectFull: RC648-665
        Type: general
      – SubjectFull: Diseases of the digestive system. Gastroenterology
        Type: general
      – SubjectFull: RC799-869
        Type: general
    Titles:
      – TitleFull: Genetic alterations in anaplastic thyroid carcinoma
        Type: main
  BibRelationships:
    HasContributorRelationships:
      – PersonEntity:
          Name:
            NameFull: M Rashid
      – PersonEntity:
          Name:
            NameFull: Amit Agarwal
      – PersonEntity:
          Name:
            NameFull: Roma Pradhan
      – PersonEntity:
          Name:
            NameFull: Nelson George
      – PersonEntity:
          Name:
            NameFull: Niraj Kumari
      – PersonEntity:
          Name:
            NameFull: M Sabaretnam
      – PersonEntity:
          Name:
            NameFull: Gyan Chand
      – PersonEntity:
          Name:
            NameFull: Anjali Mishra
      – PersonEntity:
          Name:
            NameFull: Gaurav Agarwal
      – PersonEntity:
          Name:
            NameFull: Saroj Kanta Mishra
    IsPartOfRelationships:
      – BibEntity:
          Dates:
            – D: 01
              M: 01
              Type: published
              Y: 2019
          Identifiers:
            – Type: issn-print
              Value: 22308210
          Numbering:
            – Type: volume
              Value: 23
            – Type: issue
              Value: 4
          Titles:
            – TitleFull: Indian Journal of Endocrinology and Metabolism
              Type: main
ResultId 1