Academic Journal
The polymorphism analysis for CD36 among platelet donors
| Title: | The polymorphism analysis for CD36 among platelet donors |
|---|---|
| Authors: | Qilu Lyu, Yuwei Lin, Yiming Pan, Xiaoyu Guan, Xin Ji, Mozhen Peng, Qian Li, Zhijang Wang, Zhihui Zhang, Zhen Luo, Pincan Su, Jue Wang |
| Source: | Scientific Reports, Vol 14, Iss 1, Pp 1-9 (2024) |
| Publisher Information: | Nature Portfolio, 2024. |
| Publication Year: | 2024 |
| Collection: | LCC:Medicine LCC:Science |
| Subject Terms: | Platelet donors, Polymorphism, CD36, sCD36, Medicine, Science |
| More Details: | Abstract CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P |
| Document Type: | article |
| File Description: | electronic resource |
| Language: | English |
| ISSN: | 2045-2322 |
| Relation: | https://doaj.org/toc/2045-2322 |
| DOI: | 10.1038/s41598-024-58491-z |
| Access URL: | https://doaj.org/article/0dd1111aafb24e3b88278e74818b98e7 |
| Accession Number: | edsdoj.0dd1111aafb24e3b88278e74818b98e7 |
| Database: | Directory of Open Access Journals |
| Full text is not displayed to guests. | Login for full access. |
| ISSN: | 20452322 |
|---|---|
| DOI: | 10.1038/s41598-024-58491-z |
| Published in: | Scientific Reports |
| Language: | English |