Academic Journal
View in EDS
PDF Full Text
HTML Full Text

Lead biosorption and chemical composition of extracellular polymeric substances isolated from mixotrophic microalgal cultures

Bibliographic Details
Title: Lead biosorption and chemical composition of extracellular polymeric substances isolated from mixotrophic microalgal cultures
Authors: Wioleta Ciempiel, Magdalena Czemierska, Dariusz Wiącek, Marlena Szymańska, Anna Jarosz-Wilkołazka, Izabela Krzemińska
Source: Scientific Reports, Vol 15, Iss 1, Pp 1-14 (2025)
Publisher Information: Nature Portfolio, 2025.
Publication Year: 2025
Collection: LCC:Medicine
LCC:Science
Subject Terms: Exopolysaccharides, Microalgae, Mixotrophy, FTIR, Sorption, Metal removal, Medicine, Science
More Details: Abstract Extracellular polymers (EPS) produced by microalgae are considered an important factor in the process of biosorption of environmental contaminants. The study investigated the impact of mixotrophic cultivation of unicellular algae Chlorella vulgaris, Parachlorella kessleri, and Vischeria magna on the specific productivity and yield of total and soluble EPS as well as the biochemical composition and sorption properties of extracellular polymers in order to explore their potential to be used for biosorption. The results showed that the mixotrophic conditions enhanced the productivity and contributed to changes in the biochemical and monomer composition of EPS. Higher levels of total sugars, reducing sugars, protein, and phenolic compounds and reduced content of uronic acids were observed in the EPS isolated in the mixotrophic conditions. Rhamnose, xylose, mannose, glucose, and galactose were detected in the mixotrophic EPS samples. FTIR and ICP-OES were applied to characterise the structure of EPS and their role in Pb(II) removal. The results showed that the carboxyl groups and hydroxyl groups observed in the mixotrophic EPS played an important role in the Pb(II) sorption process. The EPS from the mixotrophic C. vulgaris cultures showed the highest potential for the removal of Pb(II) and the highest sorption capacity.
Document Type: article
File Description: electronic resource
Language: English
ISSN: 2045-2322
Relation: https://doaj.org/toc/2045-2322
DOI: 10.1038/s41598-025-94372-9
Access URL: https://doaj.org/article/867168c7cf6e4ebbb6b8b3bd89bfc846
Accession Number: edsdoj.867168c7cf6e4ebbb6b8b3bd89bfc846
Database: Directory of Open Access Journals
Full text is not displayed to guests.
FullText Links:
  – Type: pdflink
    Url: https://content.ebscohost.com/cds/retrieve?content=AQICAHjPtM4BHU3ZchRwgzYmadcigk49r9CVlbU7V5F6lgH7WwFopnoExiVxTLsP3PLc2HyhAAAA4jCB3wYJKoZIhvcNAQcGoIHRMIHOAgEAMIHIBgkqhkiG9w0BBwEwHgYJYIZIAWUDBAEuMBEEDJbPwuCxeagbgje-MQIBEICBmhQE6qZEsPbNG9alcEXk8qmJ-DI7mm3xtMtVEbLlku6HysFWxSGK3s97EH4abn-5s_sD6gJ6lAdrRUCsfEWtbfSVa2TG3ah_5Jyv8PwQXjCx_l4TIIOG5Gtl-mumojL1jTiNoQFSsO5GulE8F40BE0P93jS4KiDjrQ2hc70sy1aNj0uiqWrMfLfy4eKkMrBduVMeM8Ka2df-N9s=
Text:
  Availability: 1
  Value: <anid>AN0182076380;[fkqs]02jan.25;2025Jan09.01:57;v2.2.500</anid> <title id="AN0182076380-1">The prevalence of multidrug resistance in Staphylococcus hominis isolated from clinical materials </title> <p>The treatment of infections caused by Staphylococcus hominis remains a challenge, mainly due to the increasing resistance of these bacteria to antibiotics. The aim of the study was to determine antibiotic resistance in 62 strains S. hominis isolated from clinical materials, and to identify the molecular basis of resistance to antibiotics. Forty-six strains were both methicillin-resistant and harbored the mecA gene. Twenty-three of these strains had mec complex A and ccr complex AB1. Such a combination of the mec and ccr complexes does not correspond to any cassettes that have been demonstrated so far. However, over 80% of the tested strains were multidrug-resistant, of which as many as 12 were resistant to at least seven antibiotics. More than a half of strains harbored the tetK, acc(6')-Ie aph(2"), and ant(4')-I genes. erm(C) was the most common resistant gene to antibiotics from the MLS group. Two strains had as many as five antibiotic resistance genes from the tested groups (erm(C), msr(A), msr(B), mph(C), lnu(A)). The presence of the vga gene encoding resistance to streptogramins A was detected in one strain. All of strains were sensitive to vancomycin. However, 11 of them had reduced sensitivity to this antibiotic and eight of them were characterized by a heterogeneous resistance profile to this antibiotic. Our results clearly shows increasing threat of S. hominis caused by their multi-resistance. Moreover, these bacteria can constitute a reservoir of resistance genes for more pathogenic bacteria.</p> <p>Keywords: Staphylococcus hominis; Methicillin resistance; SCCmec cassette; Multi-drug resistance gene; Medical and Health Sciences Medical Microbiology</p> <p>Supplementary Information The online version contains supplementary material available at https://doi.org/10.1038/s41598-024-84500-2.</p> <hd id="AN0182076380-2">Introduction</hd> <p> <emph>Staphyloccocus aureus</emph>, including methicillin-resistant (MRSA) as well as strains resistant to macrolides, lincosamides and streptogramin B, are so far the most popular strains among staphylococci. Hence there are many studies on these bacteria. However, due to serious infections caused by staphylococci this problem is still observed, mainly in hospital environments. Currently, multidrug-resistant coagulase-negative staphylococci (CoNS) are becoming the focus of attention. <emph>S. epidermidis</emph> is the most often isolated species. Nevertheless, other species may also be dangerous, particularly due to their multi-resistance[<reflink idref="bib1" id="ref1">1</reflink>], [<reflink idref="bib2" id="ref2">2</reflink>], [<reflink idref="bib3" id="ref3">3</reflink>], [<reflink idref="bib4" id="ref4">4</reflink>], [<reflink idref="bib5" id="ref5">5</reflink>]–[<reflink idref="bib6" id="ref6">6</reflink>]. Nowadays, <emph>S. hominis</emph> appears to be getting more and more important. <emph>S. hominis</emph> is one of the three CoNS species most frequently isolated from patients with bloodstream infections[<reflink idref="bib7" id="ref7">7</reflink>]. <emph>S. epidermidis</emph> is often reported to be predominant among these three[<reflink idref="bib8" id="ref8">8</reflink>], [<reflink idref="bib9" id="ref9">9</reflink>]–[<reflink idref="bib10" id="ref10">10</reflink>]. Cui et al. most often isolated <emph>S. hominis</emph> from patients with blood infections in tertiary care hospital in China[<reflink idref="bib6" id="ref11">6</reflink>]. Similarly, <emph>S. hominis</emph> was isolated from as many as 60% of CoNS-positive blood samples, in a tertiary care cancer centre in New Delhi, India[<reflink idref="bib11" id="ref12">11</reflink>].</p> <p> <emph>S. hominis</emph> can also cause inflammation of the endocardium, peritoneum, bones, joints, eyeball and vulvar infections, as well as purulent inflammation of the skin and subcutaneous connective tissue[<reflink idref="bib5" id="ref13">5</reflink>],[<reflink idref="bib7" id="ref14">7</reflink>],[<reflink idref="bib12" id="ref15">12</reflink>]. Two subspecies of <emph>S. hominis</emph> have been described: <emph>S. hominis</emph> subsp. <emph>hominis</emph> (SHH) and <emph>S. hominis</emph> subsp. <emph>novobiosepticus</emph> (SHN). They differ in novobiocin-resistance and the ability of aerobic acid production from D- trehalose and N- acetylglucosamine (NAG)[<reflink idref="bib13" id="ref16">13</reflink>]. SHN is most often isolated from the blood of newborns, mainly from the children with low birth weight. Moreover, it is described as multi-resistant[<reflink idref="bib7" id="ref17">7</reflink>],[<reflink idref="bib14" id="ref18">14</reflink>],[<reflink idref="bib15" id="ref19">15</reflink>]. In the treatment of the infections caused by staphylococci the most commonly used antibiotics are β-lactams that inhibit cell wall synthesis. A common feature of CoNS strains, especially those isolated from blood, is their resistance to methicillin (methicillin-resistant coagulase-negative staphylococci—MRCoNS)[<reflink idref="bib16" id="ref20">16</reflink>],[<reflink idref="bib17" id="ref21">17</reflink>]. Such relation is determined by the presence of the <emph>mecA</emph> gene encoding a penicillin-binding protein (PBP2a) with a changed conformation and lower affinity for β-lactams. Methicillin-resistant strains are usually resistant to all β-lactam antibiotics. <emph>MecA</emph> is located on a mobile genetic element, called the staphylococcal cassette chromosome (SCC<emph>mec</emph>)[<reflink idref="bib18" id="ref22">18</reflink>],[<reflink idref="bib19" id="ref23">19</reflink>]. There are 14 different cassettes known in staphylococci[<reflink idref="bib20" id="ref24">20</reflink>]. These cassettes are based on the diversity of the <emph>mec</emph> gene complex and the <emph>ccr</emph> gene complex encoding recombinases responsible for the integration of the cassettes into the chromosome[<reflink idref="bib21" id="ref25">21</reflink>]. There are various allotypes of both the <emph>mec</emph> and <emph>ccr</emph> genes. There are also cassettes elements in the chromosomes of staphylococci that contain only the genes of the <emph>ccr</emph> complex[<reflink idref="bib7" id="ref26">7</reflink>],[<reflink idref="bib20" id="ref27">20</reflink>],[<reflink idref="bib21" id="ref28">21</reflink>]. On SCC<emph>mec</emph> cassette also resistance genes to tetracyclines and aminoglycosides can be transferred. Tetracycline inhibit the protein synthesis by interacting with the 16S rRNA genes in 30S ribosome sub-unit. The most common mechanism of the acquired bacteria resistance to these tetracycline is the production of efflux pumps (efflux) and proteins that protect the ribosome. Efflux pumps encoded by the <emph>tetK</emph> and <emph>tetL</emph> genes actively remove antibiotics from the cells. Ribosome protecting proteins encoded by the <emph>tetO</emph> and <emph>tetM</emph> genes dissociate tetracyclines or prevent their binding through a conformational change in the ribosome structure[<reflink idref="bib22" id="ref29">22</reflink>]. Most often, the resistance to the aminoglycosides is a result of the drug inactivation by cell enzymes modifying aminoglycosides (AMEs). Bifunctional Aac(6')/aph(2") enzyme encoded by the <emph>acc(6')-Ie-aph(2")-Ia</emph> gene modifies all clinically available aminoglycosides except streptomycin. Aph(3')-IIIa enzyme encoded by the <emph>aph(3')-IIIa</emph> gene is responsible for the bacterial resistance to kanamycin, neomycin and amikacin. The <emph>ant(4')-Ia</emph> gene encodes Ant(4') enzyme that inactivates tobramycin, kanamycin, neomycin, and amikacin[<reflink idref="bib14" id="ref30">14</reflink>].</p> <p>Methicillin-resistance becomes an increasing problem as it is limiting therapeutic options in treatment of infections caused by staphylococci. Not only are methicillin-resistant strains insensitive to β-lactam antibiotics but they are also resistant to other antimicrobial agents. Blood infections caused by methicillin-resistant staphylococci are most frequently treated with antibiotics from the glycopeptide group, particularly with vancomycin or teicoplanin[<reflink idref="bib17" id="ref31">17</reflink>],[<reflink idref="bib23" id="ref32">23</reflink>]. However, strains characterized with decreased susceptibility to the above antibiotics are being isolated more and more often[<reflink idref="bib24" id="ref33">24</reflink>],[<reflink idref="bib25" id="ref34">25</reflink>]. Antibiotics from the MLS group (Macrolides, Lincosamides and Streptogramins) might be an alternative. Their common feature is the binding site on the ribosome of the bacterial cell. They disturb protein synthesis by combining with the 50S subunit, the 23S rRNA domain[<reflink idref="bib26" id="ref35">26</reflink>]. Unfortunately, these antibiotics are widely used, so lots of strains are resistant to them. They are used in treatment of infections caused by methicillin-resistant staphylococci as well as serve as an alternative for people who are allergic to β-lactam antibiotics[<reflink idref="bib27" id="ref36">27</reflink>]. Resistance to MLS group antibiotics may result from inactivation of the antibiotic by specific enzymes (the <emph>mph, lnu, vat</emph>, and <emph>vgb</emph> gene) encoding efflux pumps (the <emph>msr</emph> and <emph>vga</emph> gene) and modification of the antibiotic target site by methylation of rRNA (the <emph>erm</emph> gene)[<reflink idref="bib28" id="ref37">28</reflink>]. The activity of methylases encoded by the <emph>erm</emph> genes leads to cross-resistance to macrolides, lincosamides and streptogramin B (MLS<subs>B</subs>). Such MLS<subs>B</subs> resistance can manifest as either constitutive (cMLS<subs>B</subs>) resistance to all macrolides, lincosamides and streptogramin B, or inducible (iMLS<subs>B</subs>) resistance to 14- and 15-member macrolides; however in the case of the latter, the cell can also be susceptible to 16-member macrolides, lincosamides and type B streptogramins[<reflink idref="bib29" id="ref38">29</reflink>]. When determining the MLS<subs>B</subs> resistance mechanism, none of the above-mentioned antibiotics should be used in therapy.</p> <p>The aim of the study was to determine antibiotic resistance in <emph>Staphylococcus hominis</emph> strains isolated from clinical materials from hospitalized patients, and to identify the molecular basis of resistance to antibiotics.</p> <hd id="AN0182076380-3">Methods</hd> <p></p> <hd id="AN0182076380-4">Tested strains</hd> <p>The study was performed on 62 strains of <emph>Staphylococcus hominis</emph>, isolated from clinical material (mainly blood) in hospital microbiological diagnostic laboratory in Łódź, Poland. Clinical material were obtained from adult patients hospitalised on the different wards (ICU, hematology, surgery, internal diseases wards and others). The strains were identified in the laboratory using the MALDI-TOF and were added to the collection of Pharmaceutical Microbiology and Microbiological Diagnostics Department, Medical University of Lodz. Subsequently, they were genetically identified using primers specific for the species (Table 1). <emph>S. hominis</emph> subsp. <emph>hominis</emph> ATCC 27844 was applied as the control strain in PCR identification assays. Identification to subspecies was performed based on, novobiocin susceptibility and production of acid from D-trehalose and N-acetyl-D-glucosamine (NAG) under aerobic conditions[<reflink idref="bib13" id="ref39">13</reflink>].</p> <p>Table 1 Primers used in the studies.</p> <p> <ephtml> <table frame="hsides" rules="groups"><thead><tr><th align="left"><p>Target gene</p></th><th align="left"><p>Primer sequences</p></th><th align="left"><p>PCR fragment size (bp)</p></th><th align="left"><p>References</p></th></tr></thead><tbody><tr><td align="left"><p><italic>hom</italic></p></td><td align="left"><p>TACAGGGCCATTTAAAGACG</p><p>GTTTCTGGTGTATCAACACC</p></td><td align="left"><p>177</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr30">30</xref></p></td></tr><tr><td align="left"><p><italic>erm(A)</italic></p></td><td align="left"><p>GTTCAAGAACAATCAATACAGAG</p><p>GGATCAGGAAAAGGACATTTTAC</p></td><td align="left"><p>421</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr35">35</xref></p></td></tr><tr><td align="left"><p><italic>erm(B)</italic></p></td><td align="left"><p>CCGTTTACGAAATTGGAACAGGTAAAGGGC</p><p>GAATCGAGAC TTGAGTGTGC</p></td><td align="left"><p>359</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr35">35</xref></p></td></tr><tr><td align="left"><p><italic>erm(C)</italic></p></td><td align="left"><p>GCTAATATTGTTTAAATCGTCAATTCC</p><p>GGATCAGGAAAAGGACATTTTAC</p></td><td align="left"><p>572</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr35">35</xref></p></td></tr><tr><td align="left"><p><italic>msr(A)</italic></p></td><td align="left"><p>GGCACAATAAGAGTGTTTAAAGG</p><p>AAGTTATATCATGAATAGATTGTCCTGTT</p></td><td align="left"><p>940</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr35">35</xref></p></td></tr><tr><td align="left"><p><italic>msr(B)</italic></p></td><td align="left"><p>TATGATATCCATAATAATTATCCAATC</p><p>AAGTTATATCATGAATAGATTGTCCTGTT</p></td><td align="left"><p>595</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr35">35</xref></p></td></tr><tr><td align="left"><p><italic>lnu(A)</italic></p></td><td align="left"><p>GGTGGCTGGG GGGTAGATGTATTAACTGG</p><p>GCTTCTTTTGAAATACATGGTATTTTTCGATC</p></td><td align="left"><p>323</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr35">35</xref></p></td></tr><tr><td align="left"><p><italic>mph(C)</italic></p></td><td align="left"><p>GAGACTACCAAGAAGACCTGACG</p><p>CATACGCCGATTCTCCTGAT</p></td><td align="left"><p>722</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr36">36</xref></p></td></tr><tr><td align="left"><p><italic>vat(A)</italic></p></td><td align="left"><p>TGGAGTGTGACAAGATAGGC</p><p>GTGACAACAGCTTCTGCAGC</p></td><td align="left"><p>512</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr37">37</xref></p></td></tr><tr><td align="left"><p><italic>vat(B)</italic></p></td><td align="left"><p>GGCCCTGATCCAAATAGCAT</p><p>GTGCTGACCAATCCCACCAT</p></td><td align="left"><p>558</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr37">37</xref></p></td></tr><tr><td align="left"><p><italic>vat(C)</italic></p></td><td align="left"><p>ATGAATTCGCAAAATCAGCAAGG</p><p>TCGTCTCGAGCTCTAGGTCC</p></td><td align="left"><p>579</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr37">37</xref></p></td></tr><tr><td align="left"><p><italic>vga</italic></p></td><td align="left"><p>AGTGGTGGTGAAGTAACACG</p><p>CTTGTCTCCTCCGCGAATAC</p></td><td align="left"><p>659</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr37">37</xref></p></td></tr><tr><td align="left"><p><italic>vgb</italic></p></td><td align="left"><p>TGACAATATGAGTGGTGGTG</p><p>GCGACCATGAAATTGCTCTC</p></td><td align="left"><p>576</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr37">37</xref></p></td></tr><tr><td align="left"><p><italic>mecA</italic></p></td><td align="left"><p>AAAATCGATGGTAAAGGTTGGC</p><p>AGTTCTGGAGTACCGGATTTGC</p></td><td align="left"><p>553</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr38">38</xref></p></td></tr><tr><td align="left"><p><italic>aac(6')/aph(2")</italic></p></td><td align="left"><p>CCAAGAGCAATAAGGGCATACC</p><p>CACACTATCATAACCATCACCG</p></td><td align="left"><p>222</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr39">39</xref>,<xref ref-type="bibr" rid="bibr40">40</xref></p></td></tr><tr><td align="left"><p><italic>aph(3')-IIIa</italic></p></td><td align="left"><p>GGCTAAAATGAGAATATCACCGG</p><p>CTTTAAAAAATCATACAGCTCGCG</p></td><td align="left"><p>523</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr39">39</xref>,<xref ref-type="bibr" rid="bibr40">40</xref></p></td></tr><tr><td align="left"><p><italic>ant(4')-Ia</italic></p></td><td align="left"><p>CAAACTGCTAAATCGGTAGAAGCC</p><p>GGAAAGTTGACCAGACATTACGAACT</p></td><td align="left"><p>294</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr39">39</xref>,<xref ref-type="bibr" rid="bibr40">40</xref></p></td></tr><tr><td align="left"><p><italic>tetK</italic></p></td><td align="left"><p>GTAGCGACAATAGGTAATAGT</p><p>GTAGTGACAATAAACCTCCTA</p></td><td align="left"><p>360</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr41">41</xref>,<xref ref-type="bibr" rid="bibr43">43</xref></p></td></tr><tr><td align="left"><p><italic>tetL</italic></p></td><td align="left"><p>TCGTTAGCGTGCTGTCATTC</p><p>GTATCCCACCAATGTAGCCG</p></td><td align="left"><p>267</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr41">41</xref>,<xref ref-type="bibr" rid="bibr43">43</xref></p></td></tr><tr><td align="left"><p><italic>tetM</italic></p></td><td align="left"><p>AGTTTTAGCTCATGTTGATG</p><p>TCCGACTATTTAGACGACGG</p></td><td align="left"><p>1862</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr41">41</xref>,<xref ref-type="bibr" rid="bibr43">43</xref></p></td></tr><tr><td align="left"><p><italic>tetO</italic></p></td><td align="left"><p>AACTTAGGCATTCTGGCTCAC</p><p>TCCCACTGTTCCATATCGTCA</p></td><td align="left"><p>515</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr41">41</xref>,<xref ref-type="bibr" rid="bibr43">43</xref></p></td></tr><tr><td align="left"><p><italic>ccrAB1</italic></p></td><td align="left"><p>ATTGCCTTGATAATAGCCTCT</p><p>AACCTATATCATCAATCAGTACGT</p></td><td align="left"><p>700</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr45">45</xref>, <xref ref-type="bibr" rid="bibr46">46</xref>, <xref ref-type="bibr" rid="bibr47">47</xref>–<xref ref-type="bibr" rid="bibr48">48</xref></p></td></tr><tr><td align="left"><p><italic>ccrAB2</italic></p></td><td align="left"><p>ATTGCCTTGATAATAGCCITCT</p><p>TAAAGGCATCAATGCACAAACACT</p></td><td align="left"><p>1000</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr45">45</xref>, <xref ref-type="bibr" rid="bibr46">46</xref>, <xref ref-type="bibr" rid="bibr47">47</xref>–<xref ref-type="bibr" rid="bibr48">48</xref></p></td></tr><tr><td align="left"><p><italic>ccrAB3</italic></p></td><td align="left"><p>ATTGCCTTGATAATAGCCITCT</p><p>AGCTCAAAAGCAAGCAATAGAAT</p></td><td align="left"><p>1600</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr45">45</xref>, <xref ref-type="bibr" rid="bibr46">46</xref>, <xref ref-type="bibr" rid="bibr47">47</xref>–<xref ref-type="bibr" rid="bibr48">48</xref></p></td></tr><tr><td align="left"><p><italic>ccrC</italic></p></td><td align="left"><p>ATGAATTCAAAGAGCATGGC</p><p>GATTTAGAATTGTCGTGATTGC</p></td><td align="left"><p>336</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr45">45</xref>, <xref ref-type="bibr" rid="bibr46">46</xref>, <xref ref-type="bibr" rid="bibr47">47</xref>–<xref ref-type="bibr" rid="bibr48">48</xref></p></td></tr><tr><td align="left"><p><italic>mecA</italic> class A</p></td><td align="left"><p>CATAACTTCCCATTCTGCAGATG</p><p>ATGCTTAATGATAGCATCCGAATG</p></td><td align="left"><p>1965</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr45">45</xref></p></td></tr><tr><td align="left"><p><italic>mecA</italic> class B</p></td><td align="left"><p>CATAACTTCCCATTCTGCAGATG</p><p>TGAGGTTATTCAGATATTTCGATGT</p></td><td align="left"><p>2827</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr45">45</xref></p></td></tr><tr><td align="left"><p><italic>mecA</italic> class C</p></td><td align="left"><p>CATAACTTCCCATTCTGCAGATG</p><p>ATATACCAAACCCGACAACTACA</p></td><td align="left"><p>804</p></td><td align="left"><p><xref ref-type="bibr" rid="bibr45">45</xref></p></td></tr></tbody></table> </ephtml> </p> <hd id="AN0182076380-5">Detection of phenotypic resistance to antibiotics</hd> <p>The disc diffusion method (using Becton Dickinson discs) were applied to determine if the strains were resistant to the following antibiotics: cefoxitin (FOX-30), clindamycin (CC-2), erythromycin (E-15), quinupristin/dalfopristin (SYN-15), tetracycline (TE-30), gentamicin (GM-10), ciprofloxacin (CIP-5), tigecycline (TGC-15), linezolid (LZD-30), cotrimoxazole (SXT-1.25/23.75), rifampicin (RA-5), and fusidic acid (FA-10). The results were interpreted based on the EUCAST guidelines (The European Committee on Antimicrobial Susceptibility Testing)[<reflink idref="bib31" id="ref40">31</reflink>], except for LZD-30, which was tested according to CLSI guidelines (Clinical & Laboratory Standards Institute)[<reflink idref="bib32" id="ref41">32</reflink>]. Methicillin-resistant strains were tested for susceptibility to vancomycin and daptomycin by broth microdillution method according to EUCAST guidelines. <emph>Staphylococcus aureus</emph> ATCC 29,213 was used as the control strain.</p> <hd id="AN0182076380-6">Detection of vancomycin heteroresistance</hd> <p>Vancomycin heteroresistance was determined in strains with reduced susceptibility to vancomycin (MIC = 1–4 mg/L). For this purpose, bacteria were inoculated on Brain Heart Infusion (BHI) agar with 4 mg/L vancomycin according to Satola et al. method with modifications for CoNS[<reflink idref="bib33" id="ref42">33</reflink>],[<reflink idref="bib34" id="ref43">34</reflink>]. The bacterial cultures were cultivated overnight on blood agar, and used to prepare suspensions of 0.5 McFarland density. Four 10 μL drops of the suspension were placed on a BHI agar antibiotic plate. The plates were then incubated at 37 °C for 48 h, and the number of colonies in each drop were counted. If at least one drop contained a minimum of two colonies, the strain was regarded as heterogeneous vancomycin-intermediate <emph>S. hominis</emph> (hVISH).</p> <hd id="AN0182076380-7">Detection the MLSB resistance phenotype</hd> <p>MLS<subs>B</subs> resistance mechanisms were detected by the D-test[<reflink idref="bib31" id="ref44">31</reflink>]. The presence of erythromycin and clindamycin resistance was indicative of constitutive MLS<subs>B</subs> mechanism resistance (cMLS<subs>B</subs>). Alternatively, resistance to erythromycin and the existence of a flattening zone around the disc with clindamycin from the erythromycin indicated inducible resistance (iMLS<subs>B</subs>).</p> <hd id="AN0182076380-8">Detection of resistance genes</hd> <p>The strains were subjected to DNA isolation using the Genomic Micro AX Staphylococcus Gravity set (A&A Biotechnology) in accordance with the manufacturer's protocol. Resistance genes to macrolides, lincosamides and streptogramins B (<emph>erm</emph>(<emph>A</emph>), <emph>erm</emph>(<emph>B</emph>), <emph>erm</emph>(<emph>C</emph>), <emph>msr</emph>(<emph>A</emph>), <emph>msr</emph>(<emph>B</emph>), <emph>lnu</emph>(<emph>A</emph>), <emph>mph</emph>(C), <emph>vat(</emph>A), <emph>vat(B), vat(C) vga, vgb</emph>), genes conditioning resistance to β-lactam antibiotics (<emph>mecA</emph>), aminoglycosides (<emph>aac(6')/aph(2")</emph>, <emph>aph(3')-IIIa</emph>, <emph>ant(4')-Ia</emph>) and tetracyclines (<emph>tetK, tetL, tetM, tetO</emph>) were identified by PCR. The primer sequences used in the studies and the sizes of the PCR products are presented in Table 1. The obtained PCR reaction products were split electrophoretically in 1% agarose gel with Midori Green DNA Advance Stain (NIPPON Genetics Europe GmbH, Germany). The strains of the bacteria harboring particular genes and belonging to the collection of Pharmaceutical Microbiology and Microbiological Diagnostics Department, Medical University of Lodz were applied as positive controls[<reflink idref="bib16" id="ref45">16</reflink>],[<reflink idref="bib44" id="ref46">44</reflink>]. The genes, for which there were no positive controls (<emph>vat(A), vat(B), vat(C) vga, vgb)</emph> were sent to sequencing (Genomed, Poland). The results were being compared with sequences deposited in the GenBank database and being placed there.</p> <hd id="AN0182076380-9">An SCCmec analysis by PCR</hd> <p>SCC<emph>mec</emph> cassette typing was performed as described previously[<reflink idref="bib45" id="ref47">45</reflink>], [<reflink idref="bib46" id="ref48">46</reflink>], [<reflink idref="bib47" id="ref49">47</reflink>]–[<reflink idref="bib48" id="ref50">48</reflink>]. The search focused on the <emph>ccrAB1</emph>, <emph>ccrAB2</emph>, <emph>ccrAB3</emph>, and <emph>ccrC</emph> gene complexes and <emph>mecA</emph> class A, class B, and class C, complexes. Cassettes, in which it was not possible to determine the <emph>ccr</emph> and/or <emph>mec</emph> gene complex by PCR assays were labelled "non-typeable" (NT). Cassettes containing a previously undefined combination of these genes were labelled "not yet detected"[<reflink idref="bib21" id="ref51">21</reflink>]. The primer sequences used in the studies and the sizes of the PCR products are presented in Table 1.</p> <hd id="AN0182076380-10">Statistical analysis</hd> <p>The relationship between antibiotic resistance and the presence of genes and between cassette type and phenotypic antibiotic resistance and between cassette type and gene presence were determined by the chi-squared test. <emph>p</emph> < 0.05 was interpreted as significant. For the statistical analysis, STATISTICA 13.1PL software was applied (StatSoft 2016, Poland).</p> <hd id="AN0182076380-11">Results</hd> <p>Of 62 identified <emph>S. hominis</emph> strains, only two were classified as <emph>S. hominis</emph> subsp. <emph>novobiosepticus</emph>. They were resistant to novobiocin and unable to produce acid from trehalose and NAG under aerobic conditions. The other strains were classified as <emph>S.</emph><emph>hominis</emph> subsp. <emph>hominis</emph>. 46 strains were both methicillin-resistant, all of them harbored the <emph>mecA</emph> gene. This relationship was statistically significant (<emph>p</emph> < 0.05). Twenty three of these strains had <emph>mec</emph> complex A and <emph>ccr</emph> complex AB1. Such a combination of the <emph>mec</emph> and <emph>ccr</emph> complexes does not correspond to any cassettes that have been demonstrated so far. Two strains had cassettes type V and the remaining cassettes were non-typeable. The <emph>mec</emph> and <emph>ccr</emph> complex combinations and cassette types detected in the tested strains are summarised in Table 2. The strains that were sensitive to methicillin did not have the <emph>mecA</emph> gene.</p> <p>Table 2 SCC<emph>mec</emph> types present in tested strains and combinations of <emph>mec</emph> complex class and <emph>ccr</emph> complex type.</p> <p> <ephtml> <table frame="hsides" rules="groups"><thead><tr><th align="left"><p><italic>mec</italic> complex class + <italic>ccr</italic> complex type</p></th><th align="left"><p>Cassette type</p></th><th align="left"><p>No. of strains</p></th></tr></thead><tbody><tr><td align="left"><p><italic>ccrAB1</italic></p></td><td align="left"><p>NT</p></td><td align="left"><p>10</p></td></tr><tr><td align="left"><p><italic>ccrAB4</italic></p></td><td align="left"><p>NT</p></td><td align="left"><p>1</p></td></tr><tr><td align="left"><p><italic>ccrAB1</italic>; <italic>ccrC</italic></p></td><td align="left"><p>NT</p></td><td align="left"><p>2</p></td></tr><tr><td align="left"><p><italic>ccrAB1</italic>;<italic> ccrAB4</italic></p></td><td align="left"><p>NT</p></td><td align="left"><p>2</p></td></tr><tr><td align="left"><p><italic>mecA</italic> + <italic>ccrAB1</italic></p></td><td align="left"><p>NEW</p></td><td align="left"><p>11</p></td></tr><tr><td align="left"><p><italic>mecC</italic> + <italic>ccrC</italic></p></td><td align="left"><p>V</p></td><td align="left"><p>1</p></td></tr><tr><td align="left"><p><italic>mecA</italic> + <italic>ccrAB1</italic>; <italic>ccrC</italic></p></td><td align="left"><p>NEW</p></td><td align="left"><p>12</p></td></tr><tr><td align="left"><p><italic>mecC</italic> + ccrC; <italic>ccrAB1</italic>; <italic>ccrAB2</italic></p></td><td align="left"><p>V</p></td><td align="left"><p>1</p></td></tr></tbody></table> </ephtml> </p> <p>NT non-typeable, NEW-the cassettes that contained a previously undefined combination of genes</p> <p>The class B <emph>mecA</emph> gene, characteristic of cassettes I, IV and VI, was not detected in any strain. In five strains, neither the gene encoding the recombinase nor any of the assayed <emph>mecA</emph> gene classes were found. Some strains isolated from blood had two or even three variants of recombinases. The presence of various types of recombinases or their fragments in the bacterial genome indicates a large diversity of these genetic elements in <emph>S. hominis</emph> and may enhance the ability to transfer antibiotic resistance genes.</p> <p>More than 80% of the strains were resistant to antibiotics from at least three different groups. Of this number, 12 were resistant to at least 7 antibiotics used. Apart from cefoxitin, more than half of the strains were resistant to erythromycin, tetracycline, gentamicin, ciprofloxacin, and cotrimoxazole. Only one tested strain was resistant to linezolid. All strains were sensitive to streptogramin A and B quinupristin/dalfopristin combination. The prevalence of antibiotic resistance to the tested antibiotics is shown in Fig. 1.</p> <p>Graph: Fig. 1 Antibiotic resistance in tested strains (n = 62) determined with disc-diffusion method.</p> <p>Due to the ability of transferring resistance genes to tetracyclines and aminoglycosides by SCC<emph>mec</emph> cassette, genes for resistance to these antibiotics were sought in the tested strains. Of tetracycline resistance genes (<emph>tetK, tetM, tetL, tetO</emph>), the most common was the <emph>tetK</emph> gene, encoding a protein that pumps the antibiotic out of the cell. It was present in 52 strains. The relationship between the presence of the <emph>tetK</emph> gene and the occurrence of phenotypic resistance to tetracycline was statistically significant (<emph>p</emph> = 0.0001). The presence of three aminoglycoside resistance genes was tested (<emph>acc(6')-Ie aph(2"), aph(3')-IIIa, ant(4')-Ia</emph>). The <emph>ant(4')-Ia</emph> gene encoding an enzyme that inactivates tobramycin, kanamycin, neomycin and amikacin was present in 98% of the strains. The <emph>acc(6')-Ie aph(2")</emph> gene was present in 68% of the strains. This gene is responsible for modifying all clinically available aminoglycosides except for streptomycin. The relationship between the presence of the <emph>acc(6')-Ie aph(2")</emph> gene and occurrence of phenotypic resistance to gentamicin was statistically significant (<emph>p</emph> = 0.0003). 69% of the strains had both the abovementioned genes. The occurrence of resistance genes in strains harboring <emph>mec</emph> complex A and <emph>ccr</emph> complex AB1 is shown in Fig. 2. From existing genotypes, that were including <emph>mec</emph> complex A and <emph>ccr</emph> complex AB1, 3 strains had the set of genes: <emph>ermC</emph>, <emph>tetK</emph>, <emph>acc(6')-Ie aph(2") ant(4')-Ia, msrB, mphC and lnuA</emph> while 3 strains had the set of genes: <emph>ermC</emph>, <emph>tetK</emph>, <emph>acc(6')-Ie aph(2") ant(4')-Ia.</emph></p> <p>Graph: Fig. 2 The occurrence of resistance genes in all strains (n = 23) harboring mec complex A and ccr complex AB1. 1 – gene detected, 0—gene undetected.</p> <p>20 strains were both resistant to macrolides and lincosamides, which proves that they have the constitutive type of MLS<subs>B</subs> resistance mechanism. According to EUCAST recommendations, none of the antibiotics from the group of macrolides, lincosamides and streptogramins B should be applied. 15 strains had the iMLS<subs>B</subs> mechanism. They are sensitive to clindamycin. Yet, they may not appear to be therapeutically effective. The type of MLS<subs>B</subs> resistance mechanism was determined for tested strains. Obtained erythromycin and clindamycin resistance phenotypes are presented in Table 3.</p> <p>Table 3 The number of strains with specific resistance phenotypes to erythromycin and clindamycin. E<sups>R</sups>C<sups>R</sups> – resistant both to erythromycin and clindamycin, E<sups>R</sups>C<sups>S</sups> – resistant to erythromycin and susceptible to clindamycin, E<sups>S</sups>C<sups>R</sups>– susceptible to erythromycin and resistant to clindamycin and, E<sups>S</sups>C<sups>S</sups> – susceptible both to erythromycin and clindamycin, cMLS<subs>B</subs> – constitutive type of MLS<subs>B</subs> resistance, iMLS<subs>B</subs>—inducible type of MLS<subs>B</subs> resistance.</p> <p> <ephtml> <table frame="hsides" rules="groups"><thead><tr><th align="left"><p>Phenotypes</p></th><th align="left"><p>No. of isolates</p></th></tr></thead><tbody><tr><td align="left"><p>E<sup>R</sup>C<sup>R</sup> (cMLS<sub>B</sub>)</p></td><td align="left"><p>20</p></td></tr><tr><td align="left"><p>E<sup>R</sup>C<sup>S</sup> (iMLS<sub>B</sub>)</p></td><td align="left"><p>15</p></td></tr><tr><td align="left"><p>E<sup>R</sup>C<sup>S</sup></p></td><td align="left"><p>7</p></td></tr><tr><td align="left"><p>E<sup>S</sup>C<sup>R</sup></p></td><td align="left"><p>2</p></td></tr><tr><td align="left"><p>E<sup>S</sup>C<sup>S</sup></p></td><td align="left"><p>18</p></td></tr></tbody></table> </ephtml> </p> <p>The <emph>erm(C)</emph> gene was most commonly resistant gene to antibiotics from the MLS group. The activity of methylases encoded by the <emph>erm</emph> genes leads to cross-resistance to macrolides, lincosamides and streptogramin B. <emph>erm(C)</emph> was present in almost all strains with the MLS<subs>B</subs> mechanism. Four strains with the cMLS<subs>B</subs> type and two with the iMLS<subs>B</subs> type had no <emph>erm(C)</emph>. The relationship between the occurrence of this mechanism and the occurrence of the <emph>erm(C)</emph> gene was statistically significant (<emph>p</emph> = 0.0003). The <emph>erm(B)</emph> gene was not detected in any of the strains. The <emph>msr(B)</emph> gene was the second most common gene. It was present in almost 60% of the tested strains. Distribution of MLS antibiotics resistance genes in the tested strains is shown in Fig. 3.</p> <p>Graph: Fig. 3 Distribution of MLS antibiotics resistance genes in the tested strains. N—number of strains.</p> <p>The presence of the <emph>vga</emph> gene encoding resistance to streptogramins A was detected in one strain. Due to its rare occurrence in staphylococci, it was subject to sequencing, and the analysis of sequence was consistent in 100% with the <emph>vga</emph> gene sequences deposited in the GenBank database. No other genes encoding resistance only to streptogramins were detected. The <emph>S. hominis</emph> strain, in which the <emph>vga</emph> gene was detected, had the constitutive MLS<subs>B</subs> phenotype and the <emph>erm(C)</emph> and <emph>msr(B)</emph> genes, too. Two strains had as many as five antibiotic resistance genes from the tested groups. Table 4 shows macrolides, lincosamides and streptogramin resistance genes sets detected in the tested bacteria along with MLS antibiotics to which they were resistant.</p> <p>Table 4 MLS resistance genotypes and phenotypes occurring in the tested bacteria. n- number of isolates, CC-clindamycin, E-erythromycin, S-sensitivity to tested antibiotics from the MLS group.</p> <p> <ephtml> <table frame="hsides" rules="groups"><thead><tr><th align="left"><p>Genes (n)</p></th><th align="left"><p>Phenotype (n)</p></th></tr></thead><tbody><tr><td align="left"><p><italic>erm</italic>(C) (6)</p></td><td align="left"><p>E, CC (4); E (1); S (1)</p></td></tr><tr><td align="left"><p><italic>erm</italic>(C), <italic>msr</italic>(A) (1)</p></td><td align="left"><p>E, CC (1)</p></td></tr><tr><td align="left"><p><italic>erm</italic>(C), <italic>msr</italic>(B) (5)</p></td><td align="left"><p>E, CC (4); E (1)</p></td></tr><tr><td align="left"><p><italic>erm</italic>(C), <italic>msr</italic>(B), <italic>vga</italic> (1)</p></td><td align="left"><p>E, CC (1)</p></td></tr><tr><td align="left"><p><italic>erm</italic>(C), <italic>msr</italic>(B), <italic>lnu</italic>(A) (1)</p></td><td align="left"><p>S (1)</p></td></tr><tr><td align="left"><p><italic>erm</italic>(C), <italic>msr</italic>(A), <italic>msr</italic>(B) (1)</p></td><td align="left"><p>E, CC (1)</p></td></tr><tr><td align="left"><p><italic>erm</italic>(C), <italic>msr</italic>(A), <italic>msr</italic>(B), <italic>mph</italic>(C) (5)</p></td><td align="left"><p>E (3); E, CC (1);CC (1), S (1)</p></td></tr><tr><td align="left"><p><italic>erm</italic>(C), <italic>msr</italic>(A), <italic>msr</italic>(B), <italic>mph</italic>(C), <italic>lnu</italic>(A) (2)</p></td><td align="left"><p>E (2)</p></td></tr><tr><td align="left"><p><italic>erm</italic>(C), <italic>msr</italic>(B), <italic>mph</italic>(C) (11)</p></td><td align="left"><p>E (3); E, CC (6), S (2)</p></td></tr><tr><td align="left"><p><italic>erm</italic>(C), <italic>msr</italic>(B), <italic>lnu</italic>(A) (1)</p></td><td align="left"><p>S (1)</p></td></tr><tr><td align="left"><p><italic>erm</italic>(C), <italic>msr</italic>(B), <italic>mph</italic>(C), <italic>lnu</italic>(A) (4)</p></td><td align="left"><p>E (3); S (1)</p></td></tr><tr><td align="left"><p><italic>erm</italic>(C), <italic>mph</italic>(C) (2)</p></td><td align="left"><p>E, CC (1); S (1)</p></td></tr><tr><td align="left"><p><italic>erm</italic>(C), <italic>lnu</italic>(A) (3)</p></td><td align="left"><p>E (2); E, CC (1)</p></td></tr><tr><td align="left"><p><italic>msr</italic>(A) (2)</p></td><td align="left"><p>S (2)</p></td></tr><tr><td align="left"><p><italic>msr</italic>(A), <italic>msr</italic>(B) (1)</p></td><td align="left"><p>E (1)</p></td></tr><tr><td align="left"><p><italic>erm</italic>(A) (2)</p></td><td align="left"><p>E (1); E, CC (1)</p></td></tr></tbody></table> </ephtml> </p> <p>The most common genotype was <emph>erm(C), msr(B), mph(C)</emph>. It was present in 18% of the tested strains. 10 strains were sensitive both to erythromycin and clindamycin in spite of resistance genes which were present in them. One of them had as many as four genes: <emph>erm(C)</emph> encoding cross-resistance to MLS<subs>B</subs>, <emph>msr(A)</emph> and <emph>msr(B)</emph> encoding resistance to macrolides and streptogramins B, and <emph>mph(C)</emph> encoding resistance to macrolides. Most strains had a set of genes, while only 8 strains had one gene.</p> <p>Sensitivity to vancomycin and daptomycin was determined for methicillin-resistant strains with the broth microdillution method. According to EUCAST recommendations, all of them were sensitive to both antibiotics. Staphylococci are resistant to vancomycin for the MIC value > 4 mgL. However, 11 of them had reduced sensitivity to this antibiotic with MIC 1–4 mg/L. Moreover, 8 of them grew on BHI medium with 4 mg/L vancomycin, i.e. they were characterized by a heterogeneous resistance profile to this antibiotic. It means that its use may not provide a therapeutic effect. The strains with heterogeneous resistance profiles to vancomycin were multidrug-resistant. 5 of 8 strains had <emph>mec</emph> complex A and <emph>ccr</emph> complex AB1. Moreover, all of them were characterized with the presence of <emph>ccr</emph> complex AB1. The results are presented on Table 5.</p> <p>Table 5 Antibiotic resistance profile in strains characterized by heterogeneous vancomycin resistance profile, taking into account mec complex class and ccr complex type. SXT – cotrimoxazole, CIP – ciprofloxacin, TET – tetracycline, GM – gentamicin, CLI – clindamycin, ERY – erythromycin, FOX – cefoxitin.</p> <p> <ephtml> <table frame="hsides" rules="groups"><thead><tr><th align="left"><p>Strain</p></th><th align="left"><p>Profil oporności na antybiotyki</p></th><th align="left"><p><italic>mec</italic> complex class + <italic>ccr</italic> complex type</p></th></tr></thead><tbody><tr><td align="left"><p>6</p></td><td align="left"><p>FOX, CLI, GM</p></td><td align="left"><p><italic>mecA</italic> + <italic>ccrAB1</italic></p></td></tr><tr><td align="left"><p>11</p></td><td align="left"><p>FOX, ERY, CLI, GM, TET, SXT</p></td><td align="left"><p><italic>ccrAB1</italic></p></td></tr><tr><td align="left"><p>45</p></td><td align="left"><p>FOX, ERY, GM, TET, CIP, SXT</p></td><td align="left"><p><italic>mecA</italic> + <italic>ccrAB1</italic></p></td></tr><tr><td align="left"><p>46</p></td><td align="left"><p>FOX, ERY, CLI, GM, TET, CIP, SXT</p></td><td align="left"><p><italic>mecA</italic> + <italic>ccrAB1</italic></p></td></tr><tr><td align="left"><p>48</p></td><td align="left"><p>FOX, ERY, CLI, GM, TET, CIP, SXT</p></td><td align="left"><p><italic>mecA</italic> + <italic>ccrAB1</italic></p></td></tr><tr><td align="left"><p>51</p></td><td align="left"><p>FOX, ERY, TET, CIP, SXT</p></td><td align="left"><p><italic>mecA</italic> + <italic>ccrAB1</italic></p></td></tr><tr><td align="left"><p>52</p></td><td align="left"><p>FOX, GM, CIP, SXT</p></td><td align="left"><p><italic>mecA</italic> + <italic>ccrAB1</italic>;<italic> ccrC</italic></p></td></tr><tr><td align="left"><p>58</p></td><td align="left"><p>FOX, ERY, CLI, GM, TET, CIP, SXT</p></td><td align="left"><p><italic>ccrAB1</italic></p></td></tr></tbody></table> </ephtml> </p> <hd id="AN0182076380-12">Discussion</hd> <p>The treatment of infections caused by coagulase-negative staphylococci remains a challenge, mainly due to the increasing resistance of these bacteria to antibiotics[<reflink idref="bib1" id="ref52">1</reflink>],[<reflink idref="bib6" id="ref53">6</reflink>],[<reflink idref="bib49" id="ref54">49</reflink>]. However, most research in the area focus on the most frequently isolated species e.g. <emph>S. epidermidis</emph>, <emph>S.</emph><emph>haemolyticus</emph> and <emph>S. lugdunensis</emph>[<reflink idref="bib2" id="ref55">2</reflink>],[<reflink idref="bib3" id="ref56">3</reflink>],[<reflink idref="bib50" id="ref57">50</reflink>], [<reflink idref="bib51" id="ref58">51</reflink>]–[<reflink idref="bib52" id="ref59">52</reflink>]. In recent years, less frequently isolated species such as <emph>S.</emph><emph>hominis,</emph> have been considered more and more clinically significant. However, there is still not much data regarding molecular basis of the resistance of the species to antibiotics. Our studies can make an important contribution to this area. A great challenge was to collect the strains belonging to <emph>S. hominis</emph> strains. The laboratories often misinterpret these bacteria as contamination of the samples or classify them only to CoNS group. Previous studies have already showed that this group is not coherent and there exist substantial differences between the species. Their noticing may lead to improvement of the monitoring of the infections caused by staphylococci. The present work, examines the antibiotic resistance demonstrated by 62 strains of <emph>S. hominis</emph> isolated from clinical materials, including 48 from the blood of hospitalized patients with confirmed infection. The largest number of strains came from patients from hematology departments and ICU, which shows that they pose a particular threat to people with weakened immunity. <emph>S. hominis</emph> can be classified into 2 subspecies: <emph>S. hominis</emph> subsp. <emph>novobiosepticus</emph> and <emph>S. hominis</emph> subsp. <emph>hominis</emph>. Strains belonging to <emph>S. hominis</emph> subsp. <emph>novobiosepticus</emph> have been found to exhibit greater resistance to antibiotics and are more likely to be isolated from bloodstream infections[<reflink idref="bib13" id="ref60">13</reflink>],[<reflink idref="bib15" id="ref61">15</reflink>],[<reflink idref="bib53" id="ref62">53</reflink>]. Although most of the tested by us strains were isolated from blood, only two belonged to this subspecies. They shared a similar resistance profile to <emph>S.</emph><emph>hominis</emph> subsp. <emph>hominis</emph>, indicating that this subspecies can also cause therapeutic problems. Nevertheless, the applied identification method to the subspecies may not have been effective, as difficulties in differentiating subspecies are increasingly observed[<reflink idref="bib47" id="ref63">47</reflink>],[<reflink idref="bib54" id="ref64">54</reflink>].</p> <p>Coagulase-negative staphylococci account for a source of antibiotic resistance genes. It is associated with the fact that the bacteria are able to acquire mobile genetic elements, such as SCC<emph>mec</emph> chromosomal cassettes[<reflink idref="bib55" id="ref65">55</reflink>]. Cassettes are characterized with high variability. Their divisions and classifications are constantly changing alongside with identification of new types and subtypes. Moreover, it is not possible to determine a specific type for many strains[<reflink idref="bib20" id="ref66">20</reflink>],[<reflink idref="bib21" id="ref67">21</reflink>]. Seventy-four per cent of the tested strains were methicillin-resistant and harbored the <emph>mecA</emph> gene. Statistical significance between methicillin-resistance and the presence of the <emph>mecA</emph> gene was observed. Tested strains were isolated mainly from the blood of hospitalized patients, which can explain their multidrug resistance. The high percentage of methicillin-resistant strains among <emph>S. hominis</emph> isolated from blood is also confirmed by studies of Mendoza-Olazarán et al. Of 21 strains, as many as 81% were resistant to cefoxitin and had the <emph>mecA</emph> gene[<reflink idref="bib7" id="ref68">7</reflink>]. On the other hand, of 112 strains isolated from lymphedema examined by Kini et al. 46% were resistant to cefoxitin [<reflink idref="bib56" id="ref69">56</reflink>]. PCR method was applied in the studies of SCC<emph>mec</emph> analysis. Only two methicillin-resistant strains tested by us had a specific cassette (type V). So far, in <emph>S.</emph><emph>hominis</emph> strains, cassettes type III, VI and VIII have been most frequently detected[<reflink idref="bib57" id="ref70">57</reflink>],[<reflink idref="bib58" id="ref71">58</reflink>]. Eleven of the tested strains had a combination of <emph>mec</emph> and <emph>ccr</emph> complexes that did not correspond to any of the described cassettes (<emph>mec</emph> complex A and <emph>ccr</emph> complex AB1). Frequent occurrence of this set in <emph>S.</emph><emph>hominis</emph> is confirmed by studies of other authors[<reflink idref="bib7" id="ref72">7</reflink>],[<reflink idref="bib57" id="ref73">57</reflink>]. Twenty one cassettes were non-typeable. Moreover, difficulty in typing of the cassettes of this species is emphasized in many works. Of 17 MRSH strains studied by Mendoza-Olazarán et al., as many as 82% had untypeable cassettes. Similarly, a study by Szczuka et al. conducted on 30 strains revealed that it was not possible to determine the type of cassettes in over 80%[<reflink idref="bib7" id="ref74">7</reflink>],[<reflink idref="bib14" id="ref75">14</reflink>]. However, in strains studied by Bouchami et al. types VI and VIII of SCC<emph>mec</emph> were predominant, and 27% of strains had non-typeable cassettes. Moreover, the authors showed homology between <emph>ccrB1</emph> from the tested strains and <emph>ccrB1</emph> from <emph>S. epidermidis</emph> as well as between <emph>ccrB4</emph> from the tested strains and <emph>ccrB4</emph> from <emph>S. aureus</emph>[<reflink idref="bib57" id="ref76">57</reflink>]. This homology confirms the possibility of the transfer of the genes between the species. The problems with the identification of the cassettes may suggest that bacteria have cassettes which sequence differ from those described in the literature. Therefore, they are not detected by the usage of the standard methods. As it was showed by the presented studies, SCC<emph>mec</emph> analysis by PCR is not sufficient. In further studies that would be directed into identification of novel SCC<emph>mec</emph> elements, the application of whole-genome sequencing would be necessary.</p> <p>The cassettes may also harbor resistance genes to antibiotics other than β-lactams[<reflink idref="bib59" id="ref77">59</reflink>]. In our studies, no statistically significant relationships were observed between the cassette type and phenotypic resistance. However, over 80% of the tested strains were multidrug-resistant, of which as many as 12 were resistant to at least 7 antibiotics. These results show how dangerous <emph>S. hominis</emph> induced infections can be. They can make therapy inefficient and constitute a reservoir of resistance genes for more pathogenic bacteria. Multidrug resistance in <emph>S. hominis</emph> strains isolated from blood has been described previously. Nevertheless, it was mainly observed in <emph>S. hominis</emph> subsp. <emph>novobiosepticus</emph>[<reflink idref="bib6" id="ref78">6</reflink>],[<reflink idref="bib60" id="ref79">60</reflink>]. To our knowledge, the present study is the first to highlight such alarming multidrug resistance in a large number of <emph>S.</emph><emph>hominis</emph> subsp. <emph>hominis</emph>.</p> <p>As many as 60% of tested strains were resistant to tetracycline. They all had the <emph>tetK</emph> gene, what was statistically significant. According to the researchers, the occurrence of the <emph>tetK</emph> gene is common in <emph>S. hominis</emph> strains and additionally correlates with phenotypic resistance to tetracycline, intermediate resistance to doxycycline and sensitivity to minocycline. Literature reports indicate that most CoNS strains containing the <emph>mecA</emph> gene also carry the <emph>tetK</emph> or <emph>tetL</emph> genes[<reflink idref="bib45" id="ref80">45</reflink>]. Among 33 strains that had phenotypic resistance to gentamicin, all harbored the <emph>ant(4')-Ia</emph> gene. The second most common gene was <emph>acc(6')-Ie aph(2")</emph>, which was detected in 88% of the strains resistant to this antibiotic. The relationship between the presence of this gene and occurrence of phenotypic resistance to gentamicin was statistically significant.</p> <p>Nearly 70% of the tested strains were resistant to erythromycin. Such frequent resistance to erythromycin was described by Szczuka et al. The authors analyzed 55 <emph>S. hominis</emph> strains and observed that 75% were resistant to this antibiotic[<reflink idref="bib61" id="ref81">61</reflink>]. On the other hand, in studies of Gatermann et al. the percentage of <emph>S. hominis</emph> strains resistant to erythromycin appeared to be lower, i.e. 19%[<reflink idref="bib62" id="ref82">62</reflink>]. However, these results were obtained in 2007, which shows increasing resistance to erythromycin. In our studies, resistance to clindamycin was less common, i.e. it was observed in 35% of the strains. However, the resistance mechanism of MLS<subs>B</subs> in staphylococci limits the use of these antibiotics. Bacteria with the iMLS<subs>B</subs> resistance phenotype are susceptible to lincosamides, but their application in treatment may be ineffective. In our studies, as many as 15 strains had the inductive MLS<subs>B</subs> mechanism. This mechanism prevailed in <emph>S. hominis</emph> that was tested by Szczuka et al.[<reflink idref="bib61" id="ref83">61</reflink>]. The constitutive mechanism of MLS<subs>B</subs> was more frequent in our studies.</p> <p>We also studied the presence of genes encoding resistance to macrolides, lincosamides and streptogramins B. The most common gene was <emph>erm(C)</emph>, the expression of which leads to methylation of adenine in the 23S rRNA ribosomal subunit and development of cross-resistance to MLS<subs>B</subs> antibiotics. The occurrence of the <emph>erm(C)</emph> gene were correlated with the occurrence of this mechanism. This <emph>erm(C)</emph> gene was detected in 58% of the tested <emph>S. hominis</emph> strains. The current knowledge of the resistance mechanisms to antibiotics in <emph>S. hominis</emph> is limited. Hence, presented results may significantly contribute to the subject. The <emph>erm(C)</emph> gene is most often detected from the <emph>erm</emph> family in CoNS[<reflink idref="bib16" id="ref84">16</reflink>],[<reflink idref="bib34" id="ref85">34</reflink>],[<reflink idref="bib61" id="ref86">61</reflink>], [<reflink idref="bib62" id="ref87">62</reflink>]–[<reflink idref="bib63" id="ref88">63</reflink>]. Frequent occurrence of the <emph>erm(C)</emph> gene in <emph>S. hominis</emph> is also confirmed by other studies[<reflink idref="bib61" id="ref89">61</reflink>],[<reflink idref="bib62" id="ref90">62</reflink>]. The <emph>erm(A)</emph> gene was present in two strains tested in this work, whereas <emph>erm(B)</emph> was not detected in any strain. The <emph>erm(A)</emph> gene is found mainly in <emph>S. aureus</emph>, while the <emph>erm(B)</emph> gene is observed in β-hemolytic streptococci[<reflink idref="bib41" id="ref91">41</reflink>],[<reflink idref="bib64" id="ref92">64</reflink>]. What is interesting, is the fact that in the strains tested by Szczuka et al. the <emph>erm(A)</emph> gene was noted in 8 strains, while the <emph>erm(B)</emph> gene was found in as many as 14 strains[<reflink idref="bib61" id="ref93">61</reflink>]. This may confirm the possibility of gene exchange between various species and genera of bacteria. In our studies, <emph>erm(C)</emph> was present as a single gene in six strains, while in most of the strains, it coexisted with other genes. Moreover, it was also present in four strains sensitive to antibiotics of the MLS group. Resistance to macrolides and streptogramins B may also be caused by <emph>msr</emph> genes that encode proteins responsible for the efflux of antibiotics out of cells. <emph>msr(B)</emph> was the second most common gene resistant to antibiotics of the MLS group found in the strains that we studied, but it always coexisted with other genes. <emph>msr(A)</emph> was present only in 21% of the tested strains. Mahdy et al. conducted a study and revealed that the <emph>msr(A)</emph> gene was dominant in <emph>S. hominis</emph> strains [<reflink idref="bib34" id="ref94">34</reflink>]. The <emph>mph(C)</emph> gene was the third most common gene resistant to antibiotics of the MLS group that we identified. This gene encodes macrolide phosphotransferase. This enzyme modifies the macrolide antibiotic molecule, preventing its attachment to the 50S ribosomal subunit. The gene was detected in 45% of the tested strains, always with different genes. The rare occurrence of this gene in staphylococci has been previously described[<reflink idref="bib62" id="ref95">62</reflink>],[<reflink idref="bib65" id="ref96">65</reflink>]. The <emph>lnu(A)</emph> gene, which was found in 18 of the studied strains, may be responsible for resistance to lincosamides. More common occurrence of this gene in <emph>S. hominis</emph> was described by Szczuka et al.[<reflink idref="bib61" id="ref97">61</reflink>]. In our studies, we tried to identify the <emph>vat(A), vat(B)</emph> and <emph>vat(C)</emph> genes that are responsible for enzymatic modification of streptogramin A, the <emph>vga</emph> gene encoding protein that removes streptogramins A from bacterial cells and the <emph>vgb</emph> gene which gives resistance to streptogramins B. The <emph>vat(A), vat(B), vat(C)</emph> genes as well as <emph>vgb</emph> were not found in the tested strains. The presence of the <emph>vga</emph> gene was detected in one strain. Due to rare occurrence of this gene in staphylococci, it was sequenced. The sequence was in 98% consistent with <emph>vga</emph> gene sequences included in the GenBank. So far, there have been few reports on the occurrence of streptogramins resistance genes in CoNS. The <emph>vga</emph> gene was also detected in CoNS in studies of Sakar et al.[<reflink idref="bib66" id="ref98">66</reflink>]. The number of the strains was not sufficient, it was not possible to type the strain with prevailing genotype basing on the tested genes. In 3 strains with <emph>mec</emph> complex and <emph>ccr</emph> complex the set of the genes has repeated: <emph>ermC</emph>, <emph>tetK</emph>, <emph>acc(6')-Ie aph(2") ant(4')-Ia ermC</emph>, <emph>tetK</emph>, <emph>acc(6')-Ie aph(2") ant(4')-Ia, msrB, mphC and lnuA</emph> while in other 3 the set of: <emph>ermC</emph>, <emph>tetK</emph>, <emph>acc(6')-Ie aph(2") ant(4')-Ia</emph>.</p> <p>Nosocomial infections caused by methicillin-resistant staphylococci are treated with vancomycin. Resistance to this antibiotic is still rare, but strains with reduced susceptibility (MIC between 1 and 4 mg/L) are increasingly identified in CoNS. As many as 11 tested strains were characterized by reduced susceptibility to vancomycin. Of this number, 8 grew on BHI agar plate with 4 mg/L of vancomycin. These strains was characterized by heterogeneous resistance profiles. According to EUCAST recommendations they are sensitive to this antibiotic. Nevertheless, administration of this antibiotic in therapy may not bring desired effects. It results from modifications in the cell wall[<reflink idref="bib31" id="ref99">31</reflink>]. Yet, it is mostly due to previous contact of the bacteria with vancomycin[<reflink idref="bib67" id="ref100">67</reflink>]. The problem is increasingly emphasized in literature but it is underestimated due to the lack of recommendations. Therefore, it seems extremely important to continue studies to better understand this phenomenon. There have already been a lot of studies on the subject of <emph>S. epidermidis</emph> or <emph>S.</emph><emph>haemolyticus</emph> but mechanisms in <emph>S. hominis</emph> are still unclear[<reflink idref="bib24" id="ref101">24</reflink>],[<reflink idref="bib34" id="ref102">34</reflink>],[<reflink idref="bib51" id="ref103">51</reflink>],[<reflink idref="bib67" id="ref104">67</reflink>]. Our studies show that reduced susceptibility to vancomycin in <emph>S.</emph><emph>hominis</emph> is commonly observed. It may be associated with isolation of these bacteria from blood infections, which often happens in intensive care unit, where vancomycin is frequently administered. These results imply that it is necessary to look for alternatives in treatment of infections caused by CoNS-induced infections. What is worth highlighting 5 of 8 tested strains had <emph>mec</emph> complex A and <emph>ccr</emph> complex AB1. Moreover, all of them had <emph>ccr</emph> complex AB1. Perhaps, there is a dependence between the existence of this <emph>ccr</emph> complex and decreased sensitivity to vancomycin. It is a possible direction of future studies because there are no information in the literature that would connect these characteristics. In order to treat multidrug-resistant staphylococci new antibiotics such as daptomycin, tigecycline and quinupristin/dalfopristin are increasingly used[<reflink idref="bib68" id="ref105">68</reflink>]. Daptomycin and tigecycline are mainly used to treat acute skin infections and soft tissue infections[<reflink idref="bib68" id="ref106">68</reflink>], [<reflink idref="bib69" id="ref107">69</reflink>]–[<reflink idref="bib70" id="ref108">70</reflink>]. Quinupristin and dalfopristin are present in the form of a complex applied to treat multidrug-resistant bacterial infections[<reflink idref="bib68" id="ref109">68</reflink>],[<reflink idref="bib71" id="ref110">71</reflink>]. Its administration is however limited due to high costs and side effects. Current data indicate of low resistance to quinupristin-dalfopristin in the <emph>Staphylococcus</emph> genus[<reflink idref="bib68" id="ref111">68</reflink>]. Petinaki et al. described of this phenomenon in <emph>S. hominis</emph> strains isolated from blood[<reflink idref="bib72" id="ref112">72</reflink>]. In our studies, three strains were resistant to tigecycline, while all the other ones were sensitive to daptomycin and quinupristin/dalfopristin.</p> <p>The rapidly growing resistance to antibiotics in bacteria raises concern. Microorganisms that were previously considered harmless are no longer such. An example is <emph>S.</emph><emph>hominis</emph>, which constitutes a skin microbiome component of the skin microbiome and, as the presented studies shows, is characterized by multidrug resistance and harbors many resistance genes. Therefore, it is so important to identify mechanisms underlying this phenomenon in bacteria that are less frequently isolated from infections. This will hopefully improve the treatment and make its monitoring more effective. Hence, the continuation of the studies seems to be extremely important. For full understanding of the resistance mechanisms essential will be the usage of the more advanced methods that enable their recognition on the molecular level. As the presented studies showed, SCC<emph>mec</emph> analysis by PCR was not sufficient. In further studies that would be focused on identification of novel SCC<emph>mec</emph> elements, whole-genome sequencing would be necessary.</p> <hd id="AN0182076380-13">Acknowledgements</hd> <p>The authors would also like to thank Dorota Wawrzyniak, MA from the Foreign Language Centre of the Medical University of Lodz, Poland for a language consultation.</p> <hd id="AN0182076380-14">Author contributions</hd> <p>Conceptualization, M.Sz.; methodology, M.Sz. and PG.; investigation, M.Sz., P.G. and K.O.; resources, M.Sz.; writing—original draft preparation, M.Sz.; writing—review and editing, P.G. and M.S; visualization, M.Sz. and P.G.; supervision, M.S. All authors have read and agreed to the published version of the manuscript.</p> <hd id="AN0182076380-15">Funding</hd> <p>This study was supported by the statutory research funds (502-03/3-012-03/503-31-011) of the Medical University of Lodz.</p> <hd id="AN0182076380-16">Data availability</hd> <p>Sequence data that support the findings of this study have been deposited in the GenBank with the primary accession code PQ508370. The other datasets used and/or analyzed during the current study available from the corresponding author on reasonable request.</p> <hd id="AN0182076380-17">Ethics approval and consent to participate</hd> <p>Not applicable. In the study, informed consent was not required as the isolates included in the study were obtained as a result of standard medical care. Patients' identity as well as all their personal information were confidential.</p> <hd id="AN0182076380-18">Competing interests</hd> <p>The authors declare that they have no competing interests.</p> <hd id="AN0182076380-19">Electronic supplementary material</hd> <p>Below is the link to the electronic supplementary material.</p> <p>Graph: Supplementary Material 1</p> <hd id="AN0182076380-20">Publisher's note</hd> <p>Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.</p> <ref id="AN0182076380-21"> <title> References </title> <blist> <bibl id="bib1" idref="ref1" type="bt">1</bibl> <bibtext> Szemraj M, Grazul M, Balcerczak E, Szewczyk EM. Staphylococcal species less frequently isolated from human clinical specimens - are they a threat for hospital patients?. BMC Infect. Dis. 2020; 20: 10. 10.1186/s12879-020-4841-2</bibtext> </blist> <blist> <bibl id="bib2" idref="ref2" type="bt">2</bibl> <bibtext> Schoenfelder SMK, Lange C, Eckart M, Hennig S, Kozytska S, Ziebuhr W. Success through diversity: How Staphylococcus epidermidis establishes as a nosocomial pathogen. Int. J. Med. Microbiol. 2010; 300: 380-386. 20451447. 10.1016/j.ijmm.2010.04.011</bibtext> </blist> <blist> <bibl id="bib3" idref="ref3" type="bt">3</bibl> <bibtext> Eltwisy HO, Twisy HO, Hafez MH, Sayed IM, El-Mokhtar MA. Clinical infections, antibiotic resistance, and pathogenesis of Staphylococcus haemolyticus. Microorganisms. 2022; 10: 17. 10.3390/microorganisms10061130</bibtext> </blist> <blist> <bibl id="bib4" idref="ref4" type="bt">4</bibl> <bibtext> Dong Y, Speer CP, Glaser K. Beyond sepsis: Staphylococcus epidermidis is an underestimated but significant contributor to neonatal morbidity. Virulence. 2018; 9: 621-633. 29405832. 5955464. 10.1080/21505594.2017.1419117</bibtext> </blist> <blist> <bibl id="bib5" idref="ref5" type="bt">5</bibl> <bibtext> Natsis NE, Cohen PR. Coagulase-negative staphylococcus skin and soft tissue infections. Am. J. Clin. Dermatol. 2018; 19: 671-677. 29882122. 10.1007/s40257-018-0362-9. 0619.16004</bibtext> </blist> <blist> <bibl id="bib6" idref="ref6" type="bt">6</bibl> <bibtext> Cui, J. W, Liang, Z. X, Mo, Z. F, and Zhang, J. P. The species distribution, antimicrobial resistance and risk factors for poor outcome of coagulase-negative staphylococci bacteraemia in China. Antimicrobial Resistance Infect. Control8 (2019).</bibtext> </blist> <blist> <bibl id="bib7" idref="ref7" type="bt">7</bibl> <bibtext> Mendoza-Olazarán S. Microbiological and molecular characterization of Staphylococcus hominis Isolates from Blood. PLoS ONE. 2013; 8: 6. 10.1371/journal.pone.0061161</bibtext> </blist> <blist> <bibl id="bib8" idref="ref8" type="bt">8</bibl> <bibtext> Osaki S. Distinguishing coagulase-negative Staphylococcus bacteremia from contamination using blood-culture positive bottle detection pattern and time to positivity. J. Infect. Chemother. 2013; 26: 672-675. 10.1016/j.jiac.2020.02.004. 1318.37028</bibtext> </blist> <blist> <bibl id="bib9" idref="ref9" type="bt">9</bibl> <bibtext> Deplano A, Vandendriessche S, Nonhoff C, Dodémont M, Roisin S, Denis O. National surveillance of Staphylococcus epidermidis recovered from bloodstream infections in Belgian hospitals. J. Antimicrob. Chemother. 2016; 71: 1815-1819. 1:CAS:528:DC%2BC28XhsFeisLfJ. 27118780. 10.1093/jac/dkw086</bibtext> </blist> <blist> <bibtext> Yamada K. Clinical characteristics of methicillin-resistant coagulase-negative Staphylococcal Bacteremia in a tertiary hospital. Internal Med. 2017; 56: 781-785. 10.2169/internalmedicine.56.7715. 1372.01023</bibtext> </blist> <blist> <bibtext> Ahmed NH, Baruah FK, Grover RK. Staphylococcus hominis subsp novobiosepticus, an emerging multidrug-resistant bacterium, as a causative agent of septicaemia in cancer patients. Indian J. Med. Res. 2017; 146: 420-425. 1:CAS:528:DC%2BC1cXit1Wrtr7K. 29355151. 5793479. 10.4103/ijmr.IJMR_1362_15</bibtext> </blist> <blist> <bibtext> Uddin O, Hurst J, Alkayali T, Schmalzle SA. Staphylococcus hominis cellulitis and bacteremia associated with surgical clips. Idcases. 2022; 27: 3. 10.1016/j.idcr.2022.e01436</bibtext> </blist> <blist> <bibtext> Kloos, W.E. et al. Staphylococcus hominis subsp. novobiosepticus subsp. nov, a novel trehalose- and N-acetyl-D-glucosamine-negative, novobiocin- and multiple-antibiotic-resistant subspecies isolated from human blood cultures. Int. J. Syst. Bacteriol.48, 799–812 (1998).</bibtext> </blist> <blist> <bibtext> Szczuka E, Krzyminska S, Bogucka N, Kaznowski A. Multifactorial mechanisms of the pathogenesis of methicillin-resistant Staphylococcus hominis isolated from bloodstream infections. Antonie Van Leeuwenhoek Int. J. General Mol. Microbiol. 2018; 111: 1259-1265. 1:CAS:528:DC%2BC1cXht1KrtA%3D%3D. 10.1007/s10482-017-1007-3</bibtext> </blist> <blist> <bibtext> Chaves F, García-Alvarez N, Sanz F, Alba C, Otero JR. Nosocomial spread of a Staphylococcus hominis subsp novobiosepticus strain causing sepsis in a neonatal intensive care unit. J. Clin. Microbiol. 2005; 43: 4877-4879. 16145165. 1234135. 10.1128/JCM.43.9.4877-4879.2005</bibtext> </blist> <blist> <bibtext> Szemraj, M, Czekaj, T, Kalisz, J, and Szewczyk, E.M. Differences in distribution of MLS antibiotics resistance genes in clinical isolates of staphylococci belonging to species: S. epidermidis, S. hominis, S. haemolyticus, S. simulans and S. warneri. BMC Microbiol.19, 9 (2019).</bibtext> </blist> <blist> <bibtext> Hope, R, Livermore, D. M, Brick, G, Lillie, M, Reynolds, R, and Su, B. W. P. R. Non-susceptibility trends among staphylococci from bacteraemias in the UK and Ireland, 2001-06. J. Antimicrobial Chemotherapy62, II65–II74 (2008).</bibtext> </blist> <blist> <bibtext> Chon JW. Virulence characteristics of mecA-positive multidrug-resistant clinical coagulase-negative staphylococci. Microorganisms. 2020; 8: 19. 10.3390/microorganisms8050659. 1370.90188</bibtext> </blist> <blist> <bibtext> Katayama Y, Ito T, Hiramatsu K. A new class of genetic element, staphylococcus cassette chromosome mec, encodes methicillin resistance in Staphylococcus aureus. Antimicrobial Agents and Chemother. 2000; 44: 1549-1555. 1:CAS:528:DC%2BD3cXjs1Omu7o%3D. 10.1128/AAC.44.6.1549-1555.2000</bibtext> </blist> <blist> <bibtext> Uehara Y. Current status of staphylococcal cassette chromosome mec (SCCmec). Antibiotics-Basel. 2022; 11: 12. 1534.14037</bibtext> </blist> <blist> <bibtext> Ito T. Classification of staphylococcal cassette chromosome mec (SCCmec): Guidelines for reporting novel SCCmec elements. Antimicrobial Agents Chemother. 2009; 53: 4961-4967. 1:CAS:528:DC%2BD1MXhsF2gs7vJ. 10.1128/AAC.00579-09. 1178.65113</bibtext> </blist> <blist> <bibtext> LaPlante K, Dhand A, Wright K, Lauterio M. Re-establishing the utility of tetracycline-class antibiotics for current challenges with antibiotic resistance. Ann. Med. 2022; 54: 1686-1700. 1:CAS:528:DC%2BB38XhslamtrjM. 35723082. 9225766. 10.1080/07853890.2022.2085881</bibtext> </blist> <blist> <bibtext> Gudiol C, Cuervo G, Shaw E, Pujol M, Carratalà J. Pharmacotherapeutic options for treating Staphylococcus aureus bacteremia. Expert Opin. Pharmacother. 2017; 18: 1947-1963. 1:CAS:528:DC%2BC2sXhvFegtrzL. 29115883. 10.1080/14656566.2017.1403585</bibtext> </blist> <blist> <bibtext> Cremniter J. Decreased susceptibility to teicoplanin and vancomycin in coagulase-negative staphylococci isolated from orthopedic-device-associated infections. J. Clin. Microbiol. 2010; 48: 1428-1431. 20164270. 2849595. 10.1128/JCM.02098-09. 1367.93078</bibtext> </blist> <blist> <bibtext> Ahlstrand E, Svensson K, Persson L, Tidefelt U, Soderquist B. Glycopeptide resistance in coagulase-negative staphylococci isolated in blood cultures from patients with hematological malignancies during three decades. Eur. J. Clin. Microbiol. Infect. Dis. 2011; 30: 1349-1354. 1:CAS:528:DC%2BC3MXht12qsLnJ. 21744039. 10.1007/s10096-011-1228-8</bibtext> </blist> <blist> <bibtext> Maravić G. Macrolide resistance based on the Erm-mediated rRNA methylation. Curr. Drug Targets Infect. Disorders. 2004; 4; 3: 193-202. 10.2174/1568005043340777. 0504.40009</bibtext> </blist> <blist> <bibtext> Gammel N. Comparison of an automated plate assessment system (APAS Independence) and artificial intelligence (AI) to manual plate reading of methicillin-resistant and methicillin-susceptible Staphylococcus aureus CHROMagar Surveillance Cultures. J. Clin. Microbiol. 2021; 59: 6. 10.1128/JCM.00971-21</bibtext> </blist> <blist> <bibtext> Roberts MC, Sutcliffe J, Courvalin P, Jensen LB, Rood J, Seppala H. Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants. Antimicrobial Agents Chemother. 1999; 43: 2823-2830. 1:CAS:528:DyaK1MXnvVCqsLw%3D. 10.1128/AAC.43.12.2823</bibtext> </blist> <blist> <bibtext> Weisblum B. erythromycin resistance by ribosome modification. Antimicrobial Agents Chemother. 1995; 39: 577-585. 1:CAS:528:DyaK2MXktFWlt78%3D. 10.1128/AAC.39.3.577. 0875.62075</bibtext> </blist> <blist> <bibtext> Hirotaki S, Sasaki T, Kuwahara-Arai K, Hiramatsu K. Rapid and accurate identification of human-associated staphylococci by use of multiplex PCR. J. Clin. Microbiol. 2011; 49: 3627-3631. 1:CAS:528:DC%2BC3MXhsVOrsb3M. 21832022. 3187289. 10.1128/JCM.00488-11</bibtext> </blist> <blist> <bibtext> EUCAST. Breakpoint tables for interpretation of MICs and zone diameters, ver. 13.0. https://<ulink href="http://www.eucast.org/clinical%5fbreakpoints/:">www.eucast.org/clinical%5fbreakpoints/:</ulink> The European Committee on Antimicrobial Susceptibility Testing (2023).</bibtext> </blist> <blist> <bibtext> CLSI. Performance Standards for Antimicrobial Disk Susceptibility Tests, 13th Edition. ISBN 978-1-68440-067-6: Clinical and Laboratory Standards Institute (2020).</bibtext> </blist> <blist> <bibtext> Satola SW, Farley MM, Anderson KF, Patel JB. Comparison of detection methods for heteroresistant vancomycin-intermediate staphylococcus aureus, with the population analysis profile method as the reference method. J. Clin. Microbiol. 2011; 49: 177-183. 21048008. 10.1128/JCM.01128-10</bibtext> </blist> <blist> <bibtext> Mashaly, G. E, and El-Mahdy, R. H. Vancomycin heteroresistance in coagulase negative Staphylococcus blood stream infections from patients of intensive care units in Mansoura University Hospitals, Egypt. Ann. Clin. Microbiol. Antimicrobials16 (2017).</bibtext> </blist> <blist> <bibtext> Lina G, Quaglia A, Reverdy ME, Leclercq R, Vandenesch F, Etienne J. Distribution of genes encoding resistance to macrolides, lincosamides, and streptogramins among staphylococci. Antimicrobial Agents Chemother. 1999; 43: 1062-1066. 1:CAS:528:DyaK1MXjtVaqu7c%3D. 10.1128/AAC.43.5.1062</bibtext> </blist> <blist> <bibtext> Lüthje P, Schwarz S. Antimicrobial resistance of coagulase-negative staphylococci from bovine subclinical mastitis with particular reference to macrolide-lincosamide resistance phenotypes and genotypes. J. Antimicrobial Chemother. 2006; 57: 966-969. 10.1093/jac/dkl061. 1042.91076</bibtext> </blist> <blist> <bibtext> Soltani M, Beighton D, Philpott-Howard J, Woodford N. Mechanisms of resistance to quinupristin-dalfopristin among isolates of Enterococcus faecium from animals, raw meat, and hospital patients in western Europe. Antimicrobial Agents Chemother. 2000; 44: 433-436. 1:CAS:528:DC%2BD3cXmvFGmsw%3D%3D. 10.1128/AAC.44.2.433-436.2000</bibtext> </blist> <blist> <bibtext> Murakami K, Minamide W, Wada K, Nakamura E, Teraoka H, Watanabe S. Identification of methicillin-resistant strains of staphylococci by polymerase chain-reaction. J. Clin. Microbiol. 1991; 29: 2240-2244. 1:STN:280:DyaK38%2Fkt1Kmsw%3D%3D. 1939577. 270305. 10.1128/jcm.29.10.2240-2244.1991</bibtext> </blist> <blist> <bibtext> Schmitz FJ. The prevalence of aminoglycoside resistance and corresponding resistance genes in clinical isolates of staphylococci from 19 European hospitals. J. Antimicrobial Chemother. 1999; 43: 253-259. 1:CAS:528:DyaK1MXhsFyms7s%3D. 10.1093/jac/43.2.253. 0134.21304</bibtext> </blist> <blist> <bibtext> Vakulenko SB, Donabedian SM, Voskresenskiy AM, Zervos MJ, Lerner SA, Chow JW. Multiplex PCR for detection of aminoglycoside resistance genes in enterococci. Antimicrobial Agents Chemother. 2003; 47: 1423-1426. 1:CAS:528:DC%2BD3sXivVSms7c%3D. 10.1128/AAC.47.4.1423-1426.2003</bibtext> </blist> <blist> <bibtext> Argudin MA, Vanderhaeghen W, Butaye P. Diversity of antimicrobial resistance and virulence genes in methicillin-resistant non-Staphylococcus aureus staphylococci from veal calves. Res. Vet. Sci. 2015; 99: 10-16. 1:CAS:528:DC%2BC2MXhtVGgtLk%3D. 25637268. 10.1016/j.rvsc.2015.01.004</bibtext> </blist> <blist> <bibtext> Strommenger B, Kettlitz C, Werner G, Witte W. Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus. J. Clin. Microbiol. 2003; 41: 4089-4094. 1:CAS:528:DC%2BD3sXnvFaqtrs%3D. 12958230. 193808. 10.1128/JCM.41.9.4089-4094.2003</bibtext> </blist> <blist> <bibtext> Trzcinski K, Cooper BS, Hryniewicz W, Dowson CG. Expression of resistance to tetracyclines in strains of methicillin-resistant Staphylococcus aureus. J. Antimicrobial Chemother. 2000; 45: 763-770. 1:CAS:528:DC%2BD3cXkt1ars74%3D. 10.1093/jac/45.6.763. 0912.76016</bibtext> </blist> <blist> <bibtext> Szemraj, M, Glajzner P, and Sienkiewicz, M. Decreased susceptibility to vancomycin and other mechanisms of resistance to antibiotics in Staphylococcus epidermidis as a therapeutic problem in hospital treatment. Sci. Rep.13 (2023).</bibtext> </blist> <blist> <bibtext> Zhang KY, McClure JA, Elsayed S, Louie T, Conly JM. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 2005; 43: 5026-5033. 1:CAS:528:DC%2BD2MXhtFGqtrbM. 16207957. 1248471. 10.1128/JCM.43.10.5026-5033.2005</bibtext> </blist> <blist> <bibtext> Oliveira DC, Milheirico C, de Lencastre H. Redefining a structural variant of staphylococcal cassette chromosome mec, SCCmec type VI. Antimicrobial Agents Chemother. 2006; 50: 3457-3459. 1:CAS:528:DC%2BD28XhtVylsbnF. 10.1128/AAC.00629-06</bibtext> </blist> <blist> <bibtext> Zhang LF. Multilocus sequence typing and further genetic characterization of the enigmatic pathogen, Staphylococcus hominis. Plos One. 2013; 8: 9. 1316.15019</bibtext> </blist> <blist> <bibtext> Kondo Y. Combination of multiplex PCRs for staphylococcal cassette chromosome mec type assignment: Rapid identification system for mec, ccr, and major differences in junkyard regions. Antimicrobial Agents Chemother. 2007; 51: 264-274. 1:CAS:528:DC%2BD2sXktVartQ%3D%3D. 10.1128/AAC.00165-06</bibtext> </blist> <blist> <bibtext> Zhanel GG. Antimicrobial susceptibility of 22746 pathogens from Canadian hospitals: results of the CANWARD 2007–11 study. J. Antimicrobial Chemother. 2013; 68: i7-i22. 1:CAS:528:DC%2BC3sXlvFSqurc%3D. 10.1093/jac/dkt022</bibtext> </blist> <blist> <bibtext> Barros EM, Ceotto H, Bastos MCF, dos Santos KRN, Giambiagi-deMarval M. Staphylococcus haemolyticus as an important hospital pathogen and carrier of methicillin resistance genes. J. Clin. Microbiol. 2012; 50: 166-168. 1:CAS:528:DC%2BC38XitlGrt74%3D. 21976766. 3256717. 10.1128/JCM.05563-11</bibtext> </blist> <blist> <bibtext> Szemraj, M, Lisiecki, P, Glajzner, P, and Szewczyk, E.M. Vancomycin heteroresistance among methicillin-resistant clinical isolates S. haemolyticus, S. hominis, S. simulans, and S. warneri. Braz. J. Microbiol.54, 159–167 (2023).</bibtext> </blist> <blist> <bibtext> Heilbronner S, Foster TJ. Staphylococcus lugdunensis: A skin commensal with invasive pathogenic potential. Clin. Microbiol. Rev. 2021; 34: 18. 10.1128/CMR.00205-20. 1505.05136</bibtext> </blist> <blist> <bibtext> d'Azevedo PA, Trancesi R, Sales T, Monteiro J, Gales AC, Pignatari AC. Outbreak of Staphylococcus hominis subsp novobiosepticus bloodstream infections in Sao Paulo city, Brazil. J. Med. Microbiol. 2008; 57: 256-257. 18201999. 10.1099/jmm.0.47345-0</bibtext> </blist> <blist> <bibtext> Pereira, V.C, Romero, L.C, Pinheiro-Hubinger, L, Oliveira, A, Martins, K.B, and daCunha, M. Coagulase-negative staphylococci: a 20-year study on the antimicrobial resistance profile of blood culture isolates from a teaching hospital. Brazil. J. Infect. Dis.24, 160–169 (2020).</bibtext> </blist> <blist> <bibtext> Czekaj T, Ciszewski M, Szewczyk EM. Staphylococcus haemolyticus: An emerging threat in the twilight of the antibiotics age. Microbiology-Sgm. 2015; 161: 2061-2068. 1:CAS:528:DC%2BC28Xht1als7%2FN. 10.1099/mic.0.000178</bibtext> </blist> <blist> <bibtext> Kini P. Antibiotic resistance and mecA characterization of Staphylococcus hominis from filarial lymphedema patients in the Ahanta West District, Ghana: A cross-sectional study. Health Sci. Rep. 2023; 6: 8. 10.1002/hsr2.1104</bibtext> </blist> <blist> <bibtext> Bouchami O, Ben Hassen A, de Lencastre H, Miragaia M. Molecular epidemiology of methicillin-resistant staphylococcus hominis (MRSHo): Low clonality and reservoirs of SCCmec structural elements. Plos One. 2011; 6: 9. 10.1371/journal.pone.0021940</bibtext> </blist> <blist> <bibtext> Zong ZY, Peng CH, Lü XJ. Diversity of SCCmec elements in methicillin-resistant coagulase-negative staphylococci clinical isolates. Plos One. 2011; 6: 6. 10.1371/journal.pone.0020191. 1424.16026</bibtext> </blist> <blist> <bibtext> Liu JY. Staphylococcal chromosomal cassettes mec (SCCmec): A mobile genetic element in methicillin-resistant Staphylococcus aureus. Microbial Pathogenesis. 2016; 101: 56-67. 1:CAS:528:DC%2BC28XhvVGqtLzJ. 27836760. 10.1016/j.micpath.2016.10.028</bibtext> </blist> <blist> <bibtext> Palazzo ICV, d'Azevedo PA, Secchi C, Pignatari ACC, Darini ALD. Staphylococcus hominis subsp novobiosepticus strains causing nosocomial bloodstream infection in Brazil. J. Antimicrobial Chemother. 2008; 62: 1222-1226. 1:CAS:528:DC%2BD1cXhtl2gs7zK. 10.1093/jac/dkn375</bibtext> </blist> <blist> <bibtext> Szczuka E, Makowska N, Bosacka K, Slotwinska A, Kaznowski A. Molecular basis of resistance to macrolides, lincosamides and streptogramins in Staphylococcus hominis strains isolated from clinical specimens. Folia Microbiol. 2016; 61: 143-147. 1:CAS:528:DC%2BC2MXhtlSnur3M. 10.1007/s12223-015-0419-6</bibtext> </blist> <blist> <bibtext> Gatermann SG, Koschinski T, Friedrich S. Distribution and expression of macrolide resistance genes in coagulase-negative staphylococci. Clin. Microbiol. Infect. 2007; 13: 777-781. 1:CAS:528:DC%2BD2sXpslOltrc%3D. 17501977. 10.1111/j.1469-0691.2007.01749.x. 0995.65055</bibtext> </blist> <blist> <bibtext> Cetin ES, Gunes H, Kaya S, Aridogan BC, Demirci M. Distribution of genes encoding resistance to macrolides, lincosamides and streptogramins among clinical staphylococcal isolates in a Turkish University Hospital. J. Microbiol. Immunol. Infect. 2010; 43: 524-529. 21195981. 10.1016/S1684-1182(10)60081-3</bibtext> </blist> <blist> <bibtext> Meehan M, Cunney R, Cafferkey M. Molecular epidemiology of group B streptococci in Ireland reveals a diverse population with evidence of capsular switching. Eur. J. Clin. Microbiol. Infect. Dis. 2014; 33: 1155-1162. 24469423. 10.1007/s10096-014-2055-5</bibtext> </blist> <blist> <bibtext> Matsuoka M, Inoue M, Endo Y, Nakajima Y. Characteristic expression of three genes, msr(A), mph(C) and erm(Y), that confer resistance to macrolide antibiotics on Staphylococcus aureus. Fems Microbiol. Lett. 2003; 220: 287-293. 1:CAS:528:DC%2BD3sXisV2mtLk%3D. 12670694. 10.1016/S0378-1097(03)00134-4</bibtext> </blist> <blist> <bibtext> Sakar H, Mumcuoglu I, Aksu N, Karahan ZC, Kursun S, Kustimur S. Investigation of the rare genes related to resistance to macrolide-lincosamide and streptogramin B group antibiotics among coagulase-negative staphylococci. Mikrobiyoloji Bulteni. 2012; 46: 170-179. 1:CAS:528:DC%2BC38XptlWisb0%3D. 22639306</bibtext> </blist> <blist> <bibtext> Nunes APF. Heterogeneous resistance to vancomycin in Staphylococcus epidermidis, Staphylococcus haemolyticus and Staphylococcus warneri clinical strains: characterisation of glycopeptide susceptibility profiles and cell wall thickening. Int. J. Antimicrobial Agents. 2006; 27: 307-315. 1:CAS:528:DC%2BD28Xjs1yiu7w%3D. 10.1016/j.ijantimicag.2005.11.013. 1027.01022</bibtext> </blist> <blist> <bibtext> Shariati, A. et al. The global prevalence of Daptomycin, Tigecycline, Quinupristin/Dalfopristin, and Linezolid-resistant Staphylococcus aureus and coagulase-negative staphylococci strains: a systematic review and meta-analysis. Antimicrobial Resist Infect. Control9 (2020).</bibtext> </blist> <blist> <bibtext> Yaghoubi S. Tigecycline antibacterial activity, clinical effectiveness, and mechanisms and epidemiology of resistance: narrative review. Eur. J. Clin. Microbiol. Infect. Dis. 2022; 41: 1003-1022. 1:CAS:528:DC%2BB3MXisVyis7w%3D. 33403565. 10.1007/s10096-020-04121-1. 1510.93166</bibtext> </blist> <blist> <bibtext> Heidary M, Khosravi AD, Khoshnood S, Nasiri MJ, Soleimani S, Goudarzi M. Daptomycin. J. Antimicrobial Chemother. 2018; 73: 1-11. 1:CAS:528:DC%2BC1cXitlequrjO. 10.1093/jac/dkx349</bibtext> </blist> <blist> <bibtext> Johnston NJ, Mukhtar TA, Wright GD. Streptogramin antibiotics: Mode of action and resistance. Curr. Drug Targets. 2002; 3: 335-344. 1:CAS:528:DC%2BD38XkvFyjtbg%3D. 12102603. 10.2174/1389450023347678. 0857.22005</bibtext> </blist> <blist> <bibtext> Petinaki E, Spiliopoulou I, Maniati M, Maniatis AN. Emergence of Staphylococcus hominis strains expressing low-level resistance to quinupristin/dalfopristin in Greece. J. Antimicrobial Chemother. 2005; 55: 811-812. 1:CAS:528:DC%2BD2MXjvFymtb4%3D. 10.1093/jac/dki072</bibtext> </blist> </ref> <aug> <p>By Magdalena Szemraj; Paulina Glajzner; Kamila Olszowiec and Monika Sienkiewicz</p> <p>Reported by Author; Author; Author; Author</p> </aug> <nolink nlid="nl1" bibid="bib10" firstref="ref10"></nolink> <nolink nlid="nl2" bibid="bib11" firstref="ref12"></nolink> <nolink nlid="nl3" bibid="bib12" firstref="ref15"></nolink> <nolink nlid="nl4" bibid="bib13" firstref="ref16"></nolink> <nolink nlid="nl5" bibid="bib14" firstref="ref18"></nolink> <nolink nlid="nl6" bibid="bib15" firstref="ref19"></nolink> <nolink nlid="nl7" bibid="bib16" firstref="ref20"></nolink> <nolink nlid="nl8" bibid="bib17" firstref="ref21"></nolink> <nolink nlid="nl9" bibid="bib18" firstref="ref22"></nolink> <nolink nlid="nl10" bibid="bib19" firstref="ref23"></nolink> <nolink nlid="nl11" bibid="bib20" firstref="ref24"></nolink> <nolink nlid="nl12" bibid="bib21" firstref="ref25"></nolink> <nolink nlid="nl13" bibid="bib22" firstref="ref29"></nolink> <nolink nlid="nl14" bibid="bib23" firstref="ref32"></nolink> <nolink nlid="nl15" bibid="bib24" firstref="ref33"></nolink> <nolink nlid="nl16" bibid="bib25" firstref="ref34"></nolink> <nolink nlid="nl17" bibid="bib26" firstref="ref35"></nolink> <nolink nlid="nl18" bibid="bib27" firstref="ref36"></nolink> <nolink nlid="nl19" bibid="bib28" firstref="ref37"></nolink> <nolink nlid="nl20" bibid="bib29" firstref="ref38"></nolink> <nolink nlid="nl21" bibid="bib31" firstref="ref40"></nolink> <nolink nlid="nl22" bibid="bib32" firstref="ref41"></nolink> <nolink nlid="nl23" bibid="bib33" firstref="ref42"></nolink> <nolink nlid="nl24" bibid="bib34" firstref="ref43"></nolink> <nolink nlid="nl25" bibid="bib44" firstref="ref46"></nolink> <nolink nlid="nl26" bibid="bib45" firstref="ref47"></nolink> <nolink nlid="nl27" bibid="bib46" firstref="ref48"></nolink> <nolink nlid="nl28" bibid="bib47" firstref="ref49"></nolink> <nolink nlid="nl29" bibid="bib48" firstref="ref50"></nolink> <nolink nlid="nl30" bibid="bib49" firstref="ref54"></nolink> <nolink nlid="nl31" bibid="bib50" firstref="ref57"></nolink> <nolink nlid="nl32" bibid="bib51" firstref="ref58"></nolink> <nolink nlid="nl33" bibid="bib52" firstref="ref59"></nolink> <nolink nlid="nl34" bibid="bib53" firstref="ref62"></nolink> <nolink nlid="nl35" bibid="bib54" firstref="ref64"></nolink> <nolink nlid="nl36" bibid="bib55" firstref="ref65"></nolink> <nolink nlid="nl37" bibid="bib56" firstref="ref69"></nolink> <nolink nlid="nl38" bibid="bib57" firstref="ref70"></nolink> <nolink nlid="nl39" bibid="bib58" firstref="ref71"></nolink> <nolink nlid="nl40" bibid="bib59" firstref="ref77"></nolink> <nolink nlid="nl41" bibid="bib60" firstref="ref79"></nolink> <nolink nlid="nl42" bibid="bib61" firstref="ref81"></nolink> <nolink nlid="nl43" bibid="bib62" firstref="ref82"></nolink> <nolink nlid="nl44" bibid="bib63" firstref="ref88"></nolink> <nolink nlid="nl45" bibid="bib41" firstref="ref91"></nolink> <nolink nlid="nl46" bibid="bib64" firstref="ref92"></nolink> <nolink nlid="nl47" bibid="bib65" firstref="ref96"></nolink> <nolink nlid="nl48" bibid="bib66" firstref="ref98"></nolink> <nolink nlid="nl49" bibid="bib67" firstref="ref100"></nolink> <nolink nlid="nl50" bibid="bib68" firstref="ref105"></nolink> <nolink nlid="nl51" bibid="bib69" firstref="ref107"></nolink> <nolink nlid="nl52" bibid="bib70" firstref="ref108"></nolink> <nolink nlid="nl53" bibid="bib71" firstref="ref110"></nolink> <nolink nlid="nl54" bibid="bib72" firstref="ref112"></nolink>
CustomLinks:
  – Url: https://resolver.ebsco.com/c/xy5jbn/result?sid=EBSCO:edsdoj&genre=article&issn=20452322&ISBN=&volume=15&issue=1&date=20250301&spage=1&pages=1-14&title=Scientific Reports&atitle=Lead%20biosorption%20and%20chemical%20composition%20of%20extracellular%20polymeric%20substances%20isolated%20from%20mixotrophic%20microalgal%20cultures&aulast=Wioleta%20Ciempiel&id=DOI:10.1038/s41598-025-94372-9
    Name: Full Text Finder (for New FTF UI) (s8985755)
    Category: fullText
    Text: Find It @ SCU Libraries
    MouseOverText: Find It @ SCU Libraries
  – Url: https://doaj.org/article/867168c7cf6e4ebbb6b8b3bd89bfc846
    Name: EDS - DOAJ (s8985755)
    Category: fullText
    Text: View record from DOAJ
    MouseOverText: View record from DOAJ
Header DbId: edsdoj
DbLabel: Directory of Open Access Journals
An: edsdoj.867168c7cf6e4ebbb6b8b3bd89bfc846
RelevancyScore: 1082
AccessLevel: 3
PubType: Academic Journal
PubTypeId: academicJournal
PreciseRelevancyScore: 1081.57641601563
IllustrationInfo
Items – Name: Title
  Label: Title
  Group: Ti
  Data: Lead biosorption and chemical composition of extracellular polymeric substances isolated from mixotrophic microalgal cultures
– Name: Author
  Label: Authors
  Group: Au
  Data: <searchLink fieldCode="AR" term="%22Wioleta+Ciempiel%22">Wioleta Ciempiel</searchLink><br /><searchLink fieldCode="AR" term="%22Magdalena+Czemierska%22">Magdalena Czemierska</searchLink><br /><searchLink fieldCode="AR" term="%22Dariusz+Wiącek%22">Dariusz Wiącek</searchLink><br /><searchLink fieldCode="AR" term="%22Marlena+Szymańska%22">Marlena Szymańska</searchLink><br /><searchLink fieldCode="AR" term="%22Anna+Jarosz-Wilkołazka%22">Anna Jarosz-Wilkołazka</searchLink><br /><searchLink fieldCode="AR" term="%22Izabela+Krzemińska%22">Izabela Krzemińska</searchLink>
– Name: TitleSource
  Label: Source
  Group: Src
  Data: Scientific Reports, Vol 15, Iss 1, Pp 1-14 (2025)
– Name: Publisher
  Label: Publisher Information
  Group: PubInfo
  Data: Nature Portfolio, 2025.
– Name: DatePubCY
  Label: Publication Year
  Group: Date
  Data: 2025
– Name: Subset
  Label: Collection
  Group: HoldingsInfo
  Data: LCC:Medicine<br />LCC:Science
– Name: Subject
  Label: Subject Terms
  Group: Su
  Data: <searchLink fieldCode="DE" term="%22Exopolysaccharides%22">Exopolysaccharides</searchLink><br /><searchLink fieldCode="DE" term="%22Microalgae%22">Microalgae</searchLink><br /><searchLink fieldCode="DE" term="%22Mixotrophy%22">Mixotrophy</searchLink><br /><searchLink fieldCode="DE" term="%22FTIR%22">FTIR</searchLink><br /><searchLink fieldCode="DE" term="%22Sorption%22">Sorption</searchLink><br /><searchLink fieldCode="DE" term="%22Metal+removal%22">Metal removal</searchLink><br /><searchLink fieldCode="DE" term="%22Medicine%22">Medicine</searchLink><br /><searchLink fieldCode="DE" term="%22Science%22">Science</searchLink>
– Name: Abstract
  Label: Description
  Group: Ab
  Data: Abstract Extracellular polymers (EPS) produced by microalgae are considered an important factor in the process of biosorption of environmental contaminants. The study investigated the impact of mixotrophic cultivation of unicellular algae Chlorella vulgaris, Parachlorella kessleri, and Vischeria magna on the specific productivity and yield of total and soluble EPS as well as the biochemical composition and sorption properties of extracellular polymers in order to explore their potential to be used for biosorption. The results showed that the mixotrophic conditions enhanced the productivity and contributed to changes in the biochemical and monomer composition of EPS. Higher levels of total sugars, reducing sugars, protein, and phenolic compounds and reduced content of uronic acids were observed in the EPS isolated in the mixotrophic conditions. Rhamnose, xylose, mannose, glucose, and galactose were detected in the mixotrophic EPS samples. FTIR and ICP-OES were applied to characterise the structure of EPS and their role in Pb(II) removal. The results showed that the carboxyl groups and hydroxyl groups observed in the mixotrophic EPS played an important role in the Pb(II) sorption process. The EPS from the mixotrophic C. vulgaris cultures showed the highest potential for the removal of Pb(II) and the highest sorption capacity.
– Name: TypeDocument
  Label: Document Type
  Group: TypDoc
  Data: article
– Name: Format
  Label: File Description
  Group: SrcInfo
  Data: electronic resource
– Name: Language
  Label: Language
  Group: Lang
  Data: English
– Name: ISSN
  Label: ISSN
  Group: ISSN
  Data: 2045-2322
– Name: NoteTitleSource
  Label: Relation
  Group: SrcInfo
  Data: https://doaj.org/toc/2045-2322
– Name: DOI
  Label: DOI
  Group: ID
  Data: 10.1038/s41598-025-94372-9
– Name: URL
  Label: Access URL
  Group: URL
  Data: <link linkTarget="URL" linkTerm="https://doaj.org/article/867168c7cf6e4ebbb6b8b3bd89bfc846" linkWindow="_blank">https://doaj.org/article/867168c7cf6e4ebbb6b8b3bd89bfc846</link>
– Name: AN
  Label: Accession Number
  Group: ID
  Data: edsdoj.867168c7cf6e4ebbb6b8b3bd89bfc846
PLink https://login.libproxy.scu.edu/login?url=https://search.ebscohost.com/login.aspx?direct=true&site=eds-live&scope=site&db=edsdoj&AN=edsdoj.867168c7cf6e4ebbb6b8b3bd89bfc846
RecordInfo BibRecord:
  BibEntity:
    Identifiers:
      – Type: doi
        Value: 10.1038/s41598-025-94372-9
    Languages:
      – Text: English
    PhysicalDescription:
      Pagination:
        PageCount: 14
        StartPage: 1
    Subjects:
      – SubjectFull: Exopolysaccharides
        Type: general
      – SubjectFull: Microalgae
        Type: general
      – SubjectFull: Mixotrophy
        Type: general
      – SubjectFull: FTIR
        Type: general
      – SubjectFull: Sorption
        Type: general
      – SubjectFull: Metal removal
        Type: general
      – SubjectFull: Medicine
        Type: general
      – SubjectFull: Science
        Type: general
    Titles:
      – TitleFull: Lead biosorption and chemical composition of extracellular polymeric substances isolated from mixotrophic microalgal cultures
        Type: main
  BibRelationships:
    HasContributorRelationships:
      – PersonEntity:
          Name:
            NameFull: Wioleta Ciempiel
      – PersonEntity:
          Name:
            NameFull: Magdalena Czemierska
      – PersonEntity:
          Name:
            NameFull: Dariusz Wiącek
      – PersonEntity:
          Name:
            NameFull: Marlena Szymańska
      – PersonEntity:
          Name:
            NameFull: Anna Jarosz-Wilkołazka
      – PersonEntity:
          Name:
            NameFull: Izabela Krzemińska
    IsPartOfRelationships:
      – BibEntity:
          Dates:
            – D: 01
              M: 03
              Type: published
              Y: 2025
          Identifiers:
            – Type: issn-print
              Value: 20452322
          Numbering:
            – Type: volume
              Value: 15
            – Type: issue
              Value: 1
          Titles:
            – TitleFull: Scientific Reports
              Type: main
ResultId 1