Academic Journal
View in EDS
PDF Full Text
HTML Full Text

Identification of a novel heterozygous GPD1 missense variant in a Chinese adult patient with recurrent HTG-AP consuming a high-fat diet and heavy smoking

Bibliographic Details
Title: Identification of a novel heterozygous GPD1 missense variant in a Chinese adult patient with recurrent HTG-AP consuming a high-fat diet and heavy smoking
Authors: Xiao-Yao Li, Bei-Yuan Zhang, Xin-Ran Liang, Yan-Yu Han, Min-Hua Cheng, Mei Wei, Ke Cao, Xian-Cheng Chen, Ming Chen, Jian-Feng Duan, Wen-Kui Yu
Source: BMC Medical Genomics, Vol 18, Iss 1, Pp 1-14 (2025)
Publisher Information: BMC, 2025.
Publication Year: 2025
Collection: LCC:Internal medicine
LCC:Genetics
Subject Terms: Glycerol-3-phosphate dehydrogenase 1, Gene-environment interaction, Hypertriglyceridemia, Missense variant, Hypertriglyceridemia-induced acute pancreatitis, Internal medicine, RC31-1245, Genetics, QH426-470
More Details: Abstract Background Glycerol-3-phosphate dehydrogenase 1 (GPD1) gene defect can cause hypertriglyceridemia (HTG), which usually occurs in infants. The gene defect has rarely been reported in adult HTG patients. In the present study, we described the clinical and functional analyses of a novel GPD1 missense variant in a Chinese adult patient with recurrent hypertriglyceridemia‑related acute pancreatitis (HTG-AP), consuming a high-fat diet and smoking heavily. Methods Exome sequencing was used to analyze the DNA of the adult patient’s blood sample. It was found that there was a new variant of GPD1 gene-p.K327N, which was verified by gold standard-sanger sequencing method. In vitro, the corresponding plasmid was constructed and transfected into human renal HEK-293T cells, and GPD1 protein levels were detected. A biogenic analysis was performed to study the population frequency, conservation, and electric potential diagram of the new variant p.K327N. Finally, the previously reported GPD1 variants were sorted and their phenotypic relationships were compared. Results A novel heterozygous variant of GPD1, p.K327N (c.981G > C), was found in the proband. Furthermore, the patient’s daughter carried this variant, whereas his wife did not carry the variant. The proband with obesity suffered eight episodes of HTG-AP from the age of 36 years, and each onset of AP was correlated to high-fat diet consumption and heavy smoking. In vitro, this variant exerted a relatively mild effect on GPD1 functions, which were associated with its effect upon secretion (~ 25% of secretion decreased compared with that of the wild-type); thus, eventually impairing protein synthesis. Additionally, 36 patients with GPD1 variants found in previous studies showed significant transient HTG in infancy. The proband carrying the GDP1 variant was the first reported adult with recurrent HTG-AP. Conclusion We identified a novel GPD1 variant, p.K327N, in a Chinese adult male patient with recurrent HTG-AP. The variant probably exerted a mild effect on GPD1 functions. The heterozygosity of this GPD1 variant, in addition to high-fat diet consumption and heavy smoking, probably triggered HTG-AP in the patient.
Document Type: article
File Description: electronic resource
Language: English
ISSN: 1755-8794
Relation: https://doaj.org/toc/1755-8794
DOI: 10.1186/s12920-025-02088-6
Access URL: https://doaj.org/article/c48d0c25282c417fb028903c66b84834
Accession Number: edsdoj.48d0c25282c417fb028903c66b84834
Database: Directory of Open Access Journals
Full text is not displayed to guests.
FullText Links:
  – Type: pdflink
    Url: https://content.ebscohost.com/cds/retrieve?content=AQICAHjPtM4BHU3ZchRwgzYmadcigk49r9CVlbU7V5F6lgH7WwE0iXgtA3ScQi0e_KfZ5k_VAAAA4jCB3wYJKoZIhvcNAQcGoIHRMIHOAgEAMIHIBgkqhkiG9w0BBwEwHgYJYIZIAWUDBAEuMBEEDGPeAsFC0lZdKu7siAIBEICBmsYMnEwLq4LEyUbLn_-mOx7WV94arf7GCNDf4kRZtiRYFh2jh9HEWCCPXWdej33sUTWRTnFO1zV39Gzv7OQBbnGOt2AD24kZrdYlIJ2mVbIgh6z_tk3bccPtlX0vacPSmwNhqqomfthObss--EtMOkgbfbDzlpP8UgNnahKVtZobbkCx0sxaVUDH916XcS8XF8tS-2uV1v0i36I=
Text:
  Availability: 1
  Value: <anid>AN0182467571;[77ud]23jan.25;2025Jan29.03:42;v2.2.500</anid> <title id="AN0182467571-1">Identification of a novel heterozygous GPD1 missense variant in a Chinese adult patient with recurrent HTG-AP consuming a high-fat diet and heavy smoking </title> <p>Background: Glycerol-3-phosphate dehydrogenase 1 (GPD1) gene defect can cause hypertriglyceridemia (HTG), which usually occurs in infants. The gene defect has rarely been reported in adult HTG patients. In the present study, we described the clinical and functional analyses of a novel GPD1 missense variant in a Chinese adult patient with recurrent hypertriglyceridemia‑related acute pancreatitis (HTG-AP), consuming a high-fat diet and smoking heavily. Methods: Exome sequencing was used to analyze the DNA of the adult patient's blood sample. It was found that there was a new variant of GPD1 gene-p.K327N, which was verified by gold standard-sanger sequencing method. In vitro, the corresponding plasmid was constructed and transfected into human renal HEK-293T cells, and GPD1 protein levels were detected. A biogenic analysis was performed to study the population frequency, conservation, and electric potential diagram of the new variant p.K327N. Finally, the previously reported GPD1 variants were sorted and their phenotypic relationships were compared. Results: A novel heterozygous variant of GPD1, p.K327N (c.981G > C), was found in the proband. Furthermore, the patient's daughter carried this variant, whereas his wife did not carry the variant. The proband with obesity suffered eight episodes of HTG-AP from the age of 36 years, and each onset of AP was correlated to high-fat diet consumption and heavy smoking. In vitro, this variant exerted a relatively mild effect on GPD1 functions, which were associated with its effect upon secretion (~ 25% of secretion decreased compared with that of the wild-type); thus, eventually impairing protein synthesis. Additionally, 36 patients with GPD1 variants found in previous studies showed significant transient HTG in infancy. The proband carrying the GDP1 variant was the first reported adult with recurrent HTG-AP. Conclusion: We identified a novel GPD1 variant, p.K327N, in a Chinese adult male patient with recurrent HTG-AP. The variant probably exerted a mild effect on GPD1 functions. The heterozygosity of this GPD1 variant, in addition to high-fat diet consumption and heavy smoking, probably triggered HTG-AP in the patient.</p> <p>Keywords: Glycerol-3-phosphate dehydrogenase 1; Gene-environment interaction; Hypertriglyceridemia; Missense variant; Hypertriglyceridemia-induced acute pancreatitis</p> <p>Supplementary Information The online version contains supplementary material available at https://doi.org/10.1186/s12920-025-02088-6.</p> <hd id="AN0182467571-2">Introduction</hd> <p>Hypertriglyceridemia(HTG) is a common clinical condition that affects approximately 10% of the population worldwide [[<reflink idref="bib1" id="ref1">1</reflink>]]. Based on etiology, HTG is divided into primary and secondary HTG. Primary HTG is caused by gene defects related to lipid metabolism, including lipoprotein lipase(<emph>LPL</emph>), apolipoprotein C-II (<emph>APOC2</emph>), apolipoprotein A-V (<emph>APOA5</emph>), glycerol-3-phosphate dehydrogenase 1 (<emph>GPD1</emph>), glycosylphosphatidylinositol-anchored high density lipoprotein-binding protein 1(<emph>GPIHBP1</emph>), and lipase maturation factor 1 (<emph>LMF1</emph>), whereas secondary HTG is mostly caused by other diseases (E.g., obesity, diabetes, and metabolic diseases), drugs (E.g., oral drugs), unhealthy lifestyle choices (E.g., smoking), and high-fat diet consumption [[<reflink idref="bib2" id="ref2">2</reflink>]]. Moreover, an interplay has been observed between primary and secondary etiologic factors related to the occurrence of severe HTG [[<reflink idref="bib3" id="ref3">3</reflink>]]. Severe HTG increases the risk of acute pancreatitis (AP) and is the second leading cause of AP in China; thus, owing to its higher severity and recurrence rate, HTG is of great research importance [[<reflink idref="bib1" id="ref4">1</reflink>]]. Data from Western countries show that hypertriglyceridemia-induced acute pancreatitis (HTG-AP) accounts for 1.3–9% of total AP cases [[<reflink idref="bib4" id="ref5">4</reflink>]], whereas clinical research data show that HTG occurs in 10.36–35.5% of patients with AP in China [[<reflink idref="bib6" id="ref6">6</reflink>]].</p> <p>The genetic map of HTG has not been completely identified; thus, studying the genome of patients with HTG is of critical importance. <emph>GPD1</emph> gene defect can lead to HTG. GPD1 catalyzes the reversible conversion of dihydroxyacetone phosphate (DHAP) and nicotine adenine dinucleotide (NADH) to glycerol-3-phosphate (G3P) and NAD + in the cytoplasm and participates in the synthesis of glycogen, whereas owing to excess calorie intake, G3P can enter the triglyceride (TG) synthesis pathway and increase TG levels [[<reflink idref="bib8" id="ref7">8</reflink>]], indicating that gene-environment interactions are vital for disease pathogenesis.</p> <p>Individuals with frameshift, nonsense, or biallelic <emph>GPD1</emph> variants that result in almost complete loss of function develop transient infantile HTG; thus, the pathogenicity of the clinically identified <emph>GPD1</emph> missense heterozygous variant should be experimentally determined. To date, 36 patients carrying <emph>GPD1</emph> variants have been reported in infants in most cases, whereas adults with HTG carrying <emph>GPD1</emph> variants have rarely been reported. Hence, in the present study, we described the clinical and functional analyses of a novel <emph>GPD1</emph> missense variant in a Chinese adult patient with recurrent HTG-AP who consumed a high-fat diet and smoked heavily to investigate the potential of gene–environment interactions.</p> <hd id="AN0182467571-3">Methods</hd> <p></p> <hd id="AN0182467571-4">Patients</hd> <p>The proband was a 48-year-old male patient without a history of hypertension but with a 13-year history of fatty liver and a 29-year history of smoking. He suffered from AP for the first time in 2012 at the age of 36 years. He first developed AP in 2012 at the age of 36, at which time obesity was present with a body mass index (BMI) of 31.1 kg/m2. In addition, he smoked approximately 60 cigarettes per day and consumed a high-fat diet. Chylous blood samples were collected, which showed significantly increased TG levels; consequently, the condition was confirmed as severe HTG. Initially, in 2012, the condition was confirmed as HTG-AP by excluding factors such as biliary system diseases and alcohol consumption.</p> <p>The patient suffered from five bouts of recurrent HTG-AP until 2021, and his TG levels remained high (Fig. 1A). His BMI fluctuated between 25.2 and 29.2 kg/m<sups>2</sups> afterward. Moreover, the patient smoked 30 cigarettes a day and consumed 100 mg of fenofibrate a day irregularly. During the sixth episode of HTG-AP, he was admitted to the Department of Critical Care Medicine, Nanjing Drum Tower Hospital, for treatment on May 21, 2021. The patient suffered from two episodes of mild acute pancretitis (MAP) in August 2021 and May 2022, and each time, the onset of AP was related to high-fat diet consumption and heavy smoking. Later, his smoking frequency decreased (10 cigarettes a day), and he was administered a drug (fenofibrate). He kept exercising, which resulted in a normal BMI of 24 kg/m<sups>2</sups>, and consumed a healthy low-fat diet. All these factors played an important role in controlling his TG levels, and no episode of AP occurred.</p> <p>Graph: Fig. 1 A. Details of TG levels and disease time points of the proband; B. Blood samples showing chylemia; C. Computed tomography scan of the patient captured during his sixth episode of HTG-AP TG: triglycerides; AP: acute pancreatitis; HTG-AP: hypertriglyceridemia-induced acute pancreatitis</p> <p>The patient's mother had a history of pancreatitis (suffered from it twice and passed away), the patient's wife and daughter(19-year-old) had no history of pancreatitis, and the family denied the history of consanguineous marriage.</p> <hd id="AN0182467571-5">Exome sequencing</hd> <p>2 mL of peripheral EDTA anticoagulant blood was drawn from the family members and genomic DNA was extracted from the blood using the Gentra Puregene blood kit (Qiagen, Dusseldorf, Germany) according to the manufacturer's instructions. Shanghai Biotecan Company was commissioned to carry out exome sequencing. After the library was constructed, Nova6000 gene sequencer was used for on-board sequencing. The effective sequencing data were compared to the reference genome (UCSC hg19) through Burrows-Wheeler Aligner (BWA). Then the Haplo type Caller module of Genome Analysis TK was used for SNP/Indel detection. It was found that the patient and his daughter had a novel variant of GPD1 gene p.K327N (c.981G > C), which was a heterozygous variant.</p> <hd id="AN0182467571-6">Polymerase chain reaction (PCR) amplification and GPD1 gene Sanger sequencing</hd> <p>Exome sequencing revealed that the patient had a new variant in the GPD1 gene p.K327N (c.981G > C). PCR primer sequences primer F sequence CCAGTTGGCACAGAAAATCC and primer R sequence CCTGTCCTCCAGTGAAAAGA were designed. Anhui General Company was commissioned to perform gold standard sanger sequencing on the DNA of the patient's blood samples, and repeated verification sequencing (3 times) was performed at the GPD1 gene locus p.K327N to verify the results.</p> <hd id="AN0182467571-7">Plasma lipid profile analysis</hd> <p>Blood samples were taken from the proband and family members after fasting for 12 h. Serum TG, TC total cholesterol (TC), high density lipoprotein cholesterol (HDL) and other biochemical indexes were measured enzymatically on an automatic analyzer (Hitachi High-Tech, 7600–120, Japan).</p> <hd id="AN0182467571-8">In vitro cell assay</hd> <p>Genewiz Company was commissioned to synthesize the GPD1 coding sequence of wild type and p.K327N mutant, and cloned into the overexpressed plasmid vector pcDNA3.1, respectively. Sanger sequencing confirmed the accuracy of the insertion sequence, and constructed GPD1 WT and GPD1 K327N plasmids. HEK-293T cells (ATCC, CRL-3216) were cultured in a medium containing 10% fetal bovine serum and 1% penicillin streptomycin. The plasmids (1.5 µg/mL) were transiently transfected into HEK-293T cells in a 6-well plate using Lipofectamine 3000 (Thermo, L3000015). After 6 h, the cells were transferred to DMEM medium containing 2% fetal bovine serum.</p> <p>48 h after transfection with plasmids (wild-type GPD1 WT, mutant GPD1 K327N, empty vector), HEK 293T cells were cleaned with ice PBS once, and then lysed with lysis buffer to extract proteins. SDS-PAGE and immunoblotting of samples were performed using the standard Western blotting procedure, strips were visualized using the Chemidoc XRS system (Clinx Scientific Instruments, Shanghai, China) and Image Lab software (CLINX Scientific Instruments, Shanghai, China) for analysis. The antibodies used were anti-Flag antibody (Abcam, ab109732) and anti-GAPDH (Santa, sc-69,778).</p> <hd id="AN0182467571-9">In silico analyses</hd> <p>Population allele frequencies of variants found in this study were evaluated using the Genome Aggregation Database (gnomAD) genome dataset [[<reflink idref="bib9" id="ref8">9</reflink>]] via VarSome [[<reflink idref="bib10" id="ref9">10</reflink>]]. Variant nomenclature was in accordance with Human Genome Variation Society (HGVS) recommendations [[<reflink idref="bib11" id="ref10">11</reflink>]]. NM_005276.4 was used as the <emph>GPD1</emph> mRNA reference sequence.</p> <p>We examined the evolutionary conservation of <emph>GPD1</emph> K327 amino acids across various species, from chimpanzee (a close evolutionary relative) to Norway rat(distant evolutionary relatives).</p> <p>Then we used the data in UCSC Genome Browser (<ulink href="http://genome.ucsc.edu/">http://genome.ucsc.edu/</ulink>) and ENCODE (<ulink href="http://genome.ucsc.edu/ENCODE/">http://genome.ucsc.edu/ENCODE/</ulink>) to show the regulatory elements with the information of histone modifications of epigenetic markers (H3K4Me1, H3K4Me3, and H3K27Ac) data.</p> <p>The three-dimensional (3D) structures and the electric potential diagram of the wild-type, mutant GPD1 proteins were predicted using PyMOL software [[<reflink idref="bib12" id="ref11">12</reflink>]].</p> <hd id="AN0182467571-10">Review of GPD1 variant carriers</hd> <p>Keywords, including "glycerol 3-phosphate dehydrogenase-1 variant", "glycerol 3-phosphate dehydrogenase-1 variants", "<emph>GPD1</emph> variant" and "<emph>GPD1</emph> mutation" were used for searching reviews in PubMed and CNH databases up to September 30, 2023. The clinical phenotype, liver function, and lipid levels of variant carriers were reviewed. The heterozygous variant carriers in the family were also recorded.</p> <hd id="AN0182467571-11">Results</hd> <p></p> <hd id="AN0182467571-12">Clinical findings and treatment of the proband</hd> <p>The patient suffered from AP for the first time in 2012 at the age of 36 years. His BMI was 31.1 kg/m<sups>2</sups>, which indicated obesity, and the patient smoked about 60 cigarettes a day and consumed a high-fat diet. He suffered from eight bouts of recurrent HTG-AP until Feb, 2024, recalling that he ate greasy food and smoked excessively right before the onset of the eight episodes of HTG-AP.</p> <p>During the sixth bout of AP on April 18, 2021, the patient experienced upper abdominal pain accompanied by nausea after overeating and heavy smoking; thus, he visited the local hospital for treatment. His BMI fluctuated between 25.2 kg/m<sups>2</sups> and 29.2 kg/m<sups>2</sups>; he smoked 30 cigarettes a day and consumed 100 mg of fenofibrate a day irregularly. Furthermore, the TG level was 30.26 mmol/L(2681.6 mg/dL), and his plasma was milky (Fig. 1B); these observations fulfilled the definition of extreme HTG by the Endocrine Society [[<reflink idref="bib13" id="ref12">13</reflink>]]. The amylase level was 403 U/L, and the computed tomography (CT) scan showed pancreatic swelling; thus, the diagnosis was confirmed to be HTG-AP. Physicians at the local hospital asked the patient to fast and abstain from drinking. Additionally, they treated him with fluid rehydration and administered rabeprazole to inhibit acids, octreotide, and ulinastatin to inhibit enzymes, and fenofibrate to manage hyperlipidemia. His TG level gradually decreased to 5.26 mmol/L (466.13 mg/dL). The infection index still fluctuated because the C-reactive protein level was up to 57.65 mg/L. Moreover, the CT scan showed pancreatic swelling. However, the patient himself decided to get a self-willed discharge on May 17, 2021. After consuming a small amount of greasy food and smoking 50 cigarettes a day, the patient again experienced abdominal pain accompanied by nausea, vomiting, and high fever (39.2 °C). Then, he was admitted to our department for treatment on May 21, 2021.</p> <p>At admission, his laboratory tests showed increased levels of amylase (133 U/L), C-reactive protein (inflammatory marker) (111.3 mg/L), and procalcitonin (0.097 ng/mL), as well as levels of abnormal liver function-total bilirubin, alanine aminotransferase, and aspartate aminotransferase were 38.4 U/L, 154 U/L, and 204 U/L, respectively. Despite the decreased leukocyte count (0.7 × 10<sups>9</sups>/L), hemoglobin level (72 g/L), and platelet count (40 × 10<sups>9</sups>/L), the results associated with severe infections were considered after excluding hematological diseases. A recombinant human granulocyte colony-stimulating factor was injected, and blood products were transfused. The abdominal CT scan showed pancreatic swelling and necrosis with local bleeding (Fig. 1C). During the patient's admission to our department, he was asked to fast, treated with gastrointestinal decompression, and administered with omeprazole and somatostatin to inhibit acids and enzymes. Additionally, fenofibrate was administered to manage hyperlipidemia. Imipenem cilastatin sodium and teicoplanin caspofungin were used for anti-infective therapy. Additionally, nadroparin calcium was used for anticoagulation therapy, and magnesium isoglycyrrhizinate was used for liver protection therapy. His TG level still fluctuated, with the highest being 5.14 mmol/L (454.89 mg/dL). The patient was provided with fat-free formula nutrition support until the discharge on June 17, 2021, when his condition improved.</p> <p>The patient had another two episodes of MAP in August 2021 and May 2022. Additionally, he experienced exocrine pancreatic difficulties and suffered from symptoms such as nausea, vomiting, and diarrhea. Moreover, he was diagnosed with diabetes mellitus in 2023. Since October 2022, his smoking frequency decreased (10 cigarettes per day), he was administered a drug (fenofibrate), and he began to exercise and consume a healthy low-fat diet, which resulted in a normal BMI (24 kg/m<sups>2</sups>) and played an important role in controlling TG levels. No episodes of AP were observed. During most of the follow-up time, his TG levels were maintained in the mild-to-moderate range (defined as 2–9.9 mmol/L according to Dron et al. [[<reflink idref="bib14" id="ref13">14</reflink>]]). In Sep 2023, the TG level raised to 19.20 mmol/L (1692.33 mg/dL), he suffered slight abdominal pain but there was no episode of pancreatitis. His TG level was 3.50 mmol/L (308.49 mg/dL) at the follow-up visit. The missense variant may increase the hepatic synthesis of TGs and is a risk factor for HTG, even when the lifestyle is relatively healthy.</p> <hd id="AN0182467571-13">Genetic findings</hd> <p>Exome sequencing revealed a novel heterozygous variant, p.K327N (c.981 g > C, p.Lys327Asn) at exon 8 of <emph>GPD1</emph>, and the mRNA reference was NM_005277.4. Sanger sequencing was performed thrice to verify the presence of the <emph>GPD1</emph> variant (Fig. 2). After testing the patient's family members (Fig. 2A), the variant was not detected in his wife but detected in his daughter(Figure 2C&D).The biochemical detection indices of the family members are shown in Table 1. His daughter and wife showed normal serum TG levels, 1.1 mmol/L (97.35 mg/dL) and 1.6 mmol/L (141.52 mg/dL), respectively. The daughter is 19 years old now and has a normal BMI of 19.5 kg/m<sups>2</sups>, which was achieved by consuming a low-fat diet and avoiding cigarettes and alcohol. The proband and the family members carried no other variants in HTG-related genes such as <emph>LPL</emph>,<emph> APOA5</emph>,<emph> APOC2</emph>,<emph> LMF1</emph>, and <emph>GPIHBP1</emph>.</p> <p>Graph: Fig. 2 Identification of a novel variant in GPD1. (A) Family pedigree. The arrow indicates the proband. GPD1 genotypes are provided for all patients. wt, wild-type; (B) Sanger sequencing electropherogram of the proband showing the heterozygous G > C single nucleotide substitution at position c.981 of GPD1 (indicated by the arrow), which would change the codon for lysine at position p.327 (underlined) to asparagine. (i.e., p.K327N); (C) p.K327N was not detected in the wife of the proband; (D) The daughter of the proband was heterozygous for the nucleotide substitution, which resulted in p.K327N. The arrow shows the nucleotide substitution from G to C</p> <p>Table 1 Biochemical detection index of the family</p> <p> <ephtml> <table frame="hsides" rules="groups"><thead><tr><th align="left"><p>Physiological Indexes</p></th><th align="left"><p>Proband</p></th><th align="left"><p>The wife of proband</p></th><th align="left"><p>The daughter of proband</p></th><th align="left"><p>Normal range</p></th></tr></thead><tbody><tr><td align="left"><p>Alanine aminotransferase (ALT)</p></td><td char="." align="char"><p>29.847</p></td><td char="." align="char"><p>18.855</p></td><td char="." align="char"><p>12.671</p></td><td align="left"><p>≤ 40U/L</p></td></tr><tr><td align="left"><p>Aspartate aminotransferase (AST)</p></td><td char="." align="char"><p>29.712</p></td><td char="." align="char"><p>22.751</p></td><td char="." align="char"><p>22.027</p></td><td align="left"><p>≤ 40U/L</p></td></tr><tr><td align="left"><p>Total bilirubin (TBIL)</p></td><td char="." align="char"><p>9.164</p></td><td char="." align="char"><p>11.726</p></td><td char="." align="char"><p>8.793</p></td><td align="left"><p>2–18µmol/L</p></td></tr><tr><td align="left"><p>Direct bilirubin (DBIL)</p></td><td char="." align="char"><p>8.538</p></td><td char="." align="char"><p>10.865</p></td><td char="." align="char"><p>8.225</p></td><td align="left"><p>2–8µmol/L</p></td></tr><tr><td align="left"><p>Albumin (ALB)</p></td><td char="." align="char"><p>45.93</p></td><td char="." align="char"><p>42.22</p></td><td char="." align="char"><p>47.02</p></td><td align="left"><p>33–55 g/L</p></td></tr><tr><td align="left"><p>Alkaline phosphatase (ALP)</p></td><td char="." align="char"><p>144.702</p></td><td char="." align="char"><p>54.918</p></td><td char="." align="char"><p>70.965</p></td><td align="left"><p>53-185U/L</p></td></tr><tr><td align="left"><p>Gamma-glutamyltransferase (γ-GT)</p></td><td char="." align="char"><p>62.599</p></td><td char="." align="char"><p>14.635</p></td><td char="." align="char"><p>16.006</p></td><td align="left"><p>Men:≤50U/L Women:≤32U/L</p></td></tr><tr><td align="left"><p>Total bile acids (TBA)</p></td><td char="." align="char"><p>6.0</p></td><td char="." align="char"><p>1.4</p></td><td char="." align="char"><p>2.0</p></td><td align="left"><p>≤ 14µmol/L</p></td></tr><tr><td align="left"><p>Triglyceride (TG)</p></td><td char="." align="char"><p>2.685</p></td><td char="." align="char"><p>1.629</p></td><td char="." align="char"><p>1.108</p></td><td align="left"><p>0.56-1.7mmol/L</p></td></tr><tr><td align="left"><p>Cholesterol (CHO)</p></td><td char="." align="char"><p>3.956</p></td><td char="." align="char"><p>4.285</p></td><td char="." align="char"><p>3.274</p></td><td align="left"><p>3.6-6.5mmol/L</p></td></tr><tr><td align="left"><p>High density lipoprotein cholesterol (HDL)</p></td><td char="." align="char"><p>0.777</p></td><td char="." align="char"><p>1.735</p></td><td char="." align="char"><p>1.409</p></td><td align="left"><p>0.83-1.96mmol/L</p></td></tr><tr><td align="left"><p>Low density lipoprotein cholesterol (LDL)</p></td><td char="." align="char"><p>2.459</p></td><td char="." align="char"><p>1.879</p></td><td char="." align="char"><p>1.425</p></td><td align="left"><p>2.07-3.10mmol/L</p></td></tr><tr><td align="left"><p>Glucose (GLU)</p></td><td char="." align="char"><p>5.8</p></td><td char="." align="char"><p>5.9</p></td><td char="." align="char"><p>4.6</p></td><td align="left"><p>3.9-6.1mmol/L</p></td></tr><tr><td align="left"><p>Glycosylated serum protein(GSP)</p></td><td char="." align="char"><p>1.749</p></td><td char="." align="char"><p>1.912</p></td><td char="." align="char"><p>1.724</p></td><td align="left"><p>0.8-2.0mmol/L</p></td></tr></tbody></table> </ephtml> </p> <hd id="AN0182467571-14">Functional characterization of the GPD1 variant p.K327N</hd> <p>For in vitro analysis, the wild type, <emph>GPD1</emph> p.K327N, and an empty vector were transiently transfected into HEK-293 T cells (Fig. 3A). After transfecting the mutant plasmid, <emph>GPD1</emph> expression was downregulated (74.9%) compared with that of the wild-type plasmid. The western blotting results are presented as the mean ± standard deviation and were analyzed using the SPSS 25.0 software package (IBM Analytics, Armonk, NY). A probability (<emph>P</emph>-value) of less than 0.05 was defined as statistically significant.</p> <p>Graph: Fig. 3 A. Functional characterization of the K327N variant. Proteins obtained from HEK293T cells that were transiently transfected with the wild-type (WT) expression vector, the mutant expression vector, and the empty vector (EV) were used for western blotting. GAPDH, loading control. The results are presented as the mean ± SD from three independent transfections, and all assays were performed in triplicates. B and C. Evolutionary conservation of K327N amino acid residues in various species. D. Functional annotation of rs28539249. The epigenetic landscape showed the enrichment of the transcription regulatory histone markers H3K4 me1, H3K4 me3, and H3K27ac and chromatin state annotation from seven cell lines in ENCODE. (ChromHMM color coding is as follows: orange, strong enhancer; yellow, weak enhancer; light green, weak transcribed; light gray, low signal). E. Predicted partial 3D structures of the wild-type (p.Lys327) and variant (p.Asn327). F. The electric potential diagram of the wild-type (p. Lys327) and variant (p. Asn327)</p> <p>The <emph>GPD1</emph> variant K327N was not reported in the East Asian population included in the Genome Aggregation Database, validating that it is a novel variant. Moreover, K327N was conserved across the species (Fig. 3B and C), suggesting that amino acids may play a role in <emph>GPD1</emph> maturity or function. The active epigenetic marker H3K4Me1 was enriched in seven cell lines, namely GM12878, H1-hESC, K562, HSMM, HUVEC, NHEK, and NHLF (Fig. 3D). The predicted partial 3D structures of the wild-type (p.K327) and variant (p.N327) are presented in Fig. 3E. The electric potential diagram (Fig. 3F) showed that the potential changed, affecting the protein function. In summary, the novel variant <emph>GPD1</emph> p. K327N may exert a mild effect on GPD1 protein function.</p> <hd id="AN0182467571-15">Review of GPD1 gene map</hd> <p>The search terms "glycerol 3-phosphate dehydrogenase-1 variant," "glycerol 3-phosphate dehydrogenase-1 variants," "<emph>GPD1</emph> mutation," and "<emph>GPD1</emph> variant" were used to search the PubMed, CNGI, and CNH databases from their inception to September 30, 2023. Eleven English [[<reflink idref="bib8" id="ref14">8</reflink>], [<reflink idref="bib15" id="ref15">15</reflink>], [<reflink idref="bib17" id="ref16">17</reflink>], [<reflink idref="bib19" id="ref17">19</reflink>], [<reflink idref="bib21" id="ref18">21</reflink>], [<reflink idref="bib23" id="ref19">23</reflink>]–[<reflink idref="bib24" id="ref20">24</reflink>]] and two Chinese articles [[<reflink idref="bib25" id="ref21">25</reflink>]] were retrieved, involving 36 patients with the <emph>GPD1</emph> variant who were not heterozygous. Six heterozygous parents of the patients were reported to suffer related clinical manifestation.</p> <p>A review of previous literature reports and the present study included 36 patients with the <emph>GPD1</emph> variant(Table 2); among them, 10 were females, 17 were males, and the gender of the remaining 9 was not indicated, and all were not heterozygous. Among them, 35 patients (97.2%) showed increased TG levels, with the highest value ranging from 1.92 to 70.56 mmol/L (169.92 to 6244.56 mg/dL) in infancy, and suffered constant state of HTG, but less than 30.0% had returned to normal during follow-up. 34 patients (94.4%) showed abnormal liver function, and 28 patients (77.8%) showed hepatic steatosis. The pathogenicity of frameshift, nonsense, or the biallelic <emph>GPD1</emph> variants in these patients was often self-evident, which resulted in the complete or almost complete loss of function, leading to the development of transient infantile hypertriglyceridemia. <emph>GPD1</emph> variants have a long term infection on TG level, although severe HTG is transient at an early age in few patients, but TG levels may not maintain normal with age spontaneously for most of these patients.</p> <p>Table 2 Summary of the key clinical and genetic data of the 36 reported biallelic patients with the <emph>GPD1</emph> variants</p> <p> <ephtml> <table frame="hsides" rules="groups"><thead><tr><th align="left"><p>Reference</p></th><th align="left"><p>Case</p></th><th align="left"><p>Age of onset</p></th><th align="left"><p>Follow up until</p></th><th align="left"><p>Gender</p></th><th align="left"><p>Country</p></th><th align="left"><p>GPD1 Variants</p></th><th align="left"><p>Location</p></th><th align="left"><p>Zygosity</p></th><th align="left"><p>Eleva-ted TG</p></th><th align="left"><p>Highest TG level(mmol/L)</p></th><th align="left"><p>Elevated transaminases</p></th><th align="left"><p>Hepatic steatosis</p></th><th align="left"><p>Clinical features</p></th></tr></thead><tbody><tr><td align="left"><p>Present</p></td><td align="left"><p>1</p></td><td align="left"><p>36y</p></td><td align="left"><p>47y</p></td><td align="left"><p>male</p></td><td align="left"><p>China</p></td><td align="left"><p>c.981G > C,</p><p>p. K327N</p></td><td align="left"><p>exon8</p></td><td align="left"><p>Heterozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>17.82</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>8 episodes of AP. Overweight</p></td></tr><tr><td align="left"><p>Basel-Vanagaite et al. (2012)</p></td><td align="left"><p>2</p></td><td align="left"><p>1 m</p></td><td align="left"><p>14y</p></td><td align="left"><p>male</p></td><td align="left"><p>Israel</p></td><td align="left"><p>c.361-1G > C, p.I119fs*94</p></td><td align="left"><p>intron3</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>70.56</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Case2-4 were from the same family; Short in stature; Obesity; Insulin resistance</p></td></tr><tr><td align="left"><p>Basel-Vanagaite et al. (2012)</p></td><td align="left"><p>3</p></td><td align="left"><p>1 m</p></td><td align="left"><p>10y</p></td><td align="left"><p>male</p></td><td align="left"><p>Israel</p></td><td align="left"><p>c.361-1G > C, p.I119fs*94</p></td><td align="left"><p>intron3</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>2.83</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Vomiting</p></td></tr><tr><td align="left"><p>Basel-Vanagaite et al. (2012)</p></td><td align="left"><p>4</p></td><td align="left"><p>4 m</p></td><td align="left"><p>12y</p></td><td align="left"><p>male</p></td><td align="left"><p>Israel</p></td><td align="left"><p>c.361-1G > C, p.I119fs*94</p></td><td align="left"><p>intron3</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>11.18</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Short in stature</p></td></tr><tr><td align="left"><p>Basel-Vanagaite et al. (2012)</p></td><td align="left"><p>5</p></td><td align="left"><p>at birth</p></td><td align="left"><p>23y</p></td><td align="left"><p>male</p></td><td align="left"><p>Israel</p></td><td align="left"><p>c.361-1G > C, p.I119fs*94</p></td><td align="left"><p>intron3</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>5.87</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>case5-6 were from the same family; Short in stature; splenomegaly</p></td></tr><tr><td align="left"><p>Basel-Vanagaite et al. (2012)</p></td><td align="left"><p>6</p></td><td align="left"><p>6 m</p></td><td align="left"><p>3y</p></td><td align="left"><p>female</p></td><td align="left"><p>Israel</p></td><td align="left"><p>c.361-1G > C, p.I119fs*94</p></td><td align="left"><p>intron3</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>13.65</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Developmental retardation</p></td></tr><tr><td align="left"><p>Basel-Vanagaite et al. (2012)</p></td><td align="left"><p>7</p></td><td align="left"><p>2.5 m</p></td><td align="left"><p>4y</p></td><td align="left"><p>female</p></td><td align="left"><p>Israel</p></td><td align="left"><p>c.361-1G > C, p.I119fs*94</p></td><td align="left"><p>intron3</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>3.94</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Case7-9 were from the same family; Vomiting</p></td></tr><tr><td align="left"><p>Basel-Vanagaite et al. (2012)</p></td><td align="left"><p>8</p></td><td align="left"><p>7 m</p></td><td align="left"><p>1y</p></td><td align="left"><p>female</p></td><td align="left"><p>Israel</p></td><td align="left"><p>c.361-1G > C, p.I119fs*94</p></td><td align="left"><p>intron3</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>2.92</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Splenomegaly</p></td></tr><tr><td align="left"><p>Basel-Vanagaite et al. (2012)</p></td><td align="left"><p>9</p></td><td align="left"><p>7 m</p></td><td align="left"><p>1y</p></td><td align="left"><p>female</p></td><td align="left"><p>Israel</p></td><td align="left"><p>c.361-1G > C, p.I119fs*94</p></td><td align="left"><p>intron3</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>2.91</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Splenomegaly</p></td></tr><tr><td align="left"><p>Basel-Vanagaite et al. (2012)</p></td><td align="left"><p>10</p></td><td align="left"><p>9 m</p></td><td align="left"><p>12y</p></td><td align="left"><p>male</p></td><td align="left"><p>Israel</p></td><td align="left"><p>c.361-1G > C, p.I119fs*94</p></td><td align="left"><p>intron3</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>3.73</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Case10-11 were from the same family; Short in stature; horseshoe kidney</p></td></tr><tr><td align="left"><p>Basel-Vanagaite et al. (2012)</p></td><td align="left"><p>11</p></td><td align="left"><p>3.5 m</p></td><td align="left"><p>12y</p></td><td align="left"><p>male</p></td><td align="left"><p>Israel</p></td><td align="left"><p>c.361-1G > C, p.I119fs*94</p></td><td align="left"><p>intron3</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>2.54</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Short in stature;</p></td></tr><tr><td align="left"><p>Li et al. (2017)</p></td><td align="left"><p>12</p></td><td align="left"><p>7y</p></td><td align="left"><p>13y</p></td><td align="left"><p>male</p></td><td align="left"><p>China</p></td><td align="left"><p>c.220–2 A > G;c.820G > A,p. A274T</p></td><td align="left"><p>intron2;exon6</p></td><td align="left"><p>Compound heterozygote</p></td><td align="left"><p>N</p></td><td align="left"><p>/</p></td><td align="left"><p>N</p></td><td align="left"><p>N</p></td><td align="left"><p>Short in stature; Obesity; Insulin resistance</p></td></tr><tr><td align="left"><p>Li et al. (2018)</p></td><td align="left"><p>13</p></td><td align="left"><p>3.5 m</p></td><td align="left"><p>NA</p></td><td align="left"><p>male</p></td><td align="left"><p>China</p></td><td align="left"><p>c.523 C > T, p. Q175*</p></td><td align="left"><p>exon4</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>10.94</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Splenomegaly</p></td></tr><tr><td align="left"><p>Ma et al. (2021)</p></td><td align="left"><p>14</p></td><td align="left"><p>1 m</p></td><td align="left"><p>1y</p></td><td align="left"><p>male</p></td><td align="left"><p>China</p></td><td align="left"><p>c.901G > T,p.E301*;c.220–2 A > G</p></td><td align="left"><p>exon7;intron2</p></td><td align="left"><p>Compound heterozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>19.08</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Liver fibrosis</p></td></tr><tr><td align="left"><p>Xie et al. (2021)</p></td><td align="left"><p>15</p></td><td align="left"><p>1 m</p></td><td align="left"><p>12 m</p></td><td align="left"><p>female</p></td><td align="left"><p>China</p></td><td align="left"><p>c.901G > T,p.E301*;</p><p>Deletion > 5.1 kb at a different locus;</p></td><td align="left"><p>exon7</p></td><td align="left"><p>Hemizygous</p></td><td align="left"><p>Y</p></td><td align="left"><p>9.2</p></td><td align="left"><p>Y</p></td><td align="left"><p>N</p></td><td align="left" /></tr><tr><td align="left"><p>Xie et al. (2021)</p></td><td align="left"><p>16</p></td><td align="left"><p>13 m</p></td><td align="left"><p>19 m</p></td><td align="left"><p>male</p></td><td align="left"><p>China</p></td><td align="left"><p>c.931 C > T,p.Q311*;c.901G > T,p.E301*</p></td><td align="left"><p>exon7;exon7</p></td><td align="left"><p>Compound heterozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>15.14</p></td><td align="left"><p>Y</p></td><td align="left"><p>N</p></td><td align="left" /></tr><tr><td align="left"><p>Dionisi-Vici et al. (2016)</p></td><td align="left"><p>17</p></td><td align="left"><p>10 m</p></td><td align="left"><p>14 m</p></td><td align="left"><p>male</p></td><td align="left"><p>Arab Muslim</p></td><td align="left"><p>c.806G > A, p.R269Q</p></td><td align="left"><p>exon6</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>1.92</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Consanguineous marriage; Liver fibrosis</p></td></tr><tr><td align="left"><p>Dionisi-Vici et al. (2016)</p></td><td align="left"><p>18</p></td><td align="left"><p>1y</p></td><td align="left"><p>3y</p></td><td align="left"><p>female</p></td><td align="left"><p>NA</p></td><td align="left"><p>c.361-1G > C, p.I119fs*94</p></td><td align="left"><p>intron3</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>13.33</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left" /></tr><tr><td align="left"><p>Dionisi-Vici et al. (2016)</p></td><td align="left"><p>19</p></td><td align="left"><p>5 m</p></td><td align="left"><p>7y</p></td><td align="left"><p>male</p></td><td align="left"><p>Italy</p></td><td align="left"><p>c.640T > C, p.C214R</p></td><td align="left"><p>exon5</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>5.27</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Consanguineous marriage, cirrhosis of the liver, dicarboxyuria</p></td></tr><tr><td align="left"><p>Dionisi-Vici et al. (2016)</p></td><td align="left"><p>20</p></td><td align="left"><p>2y</p></td><td align="left"><p>31y</p></td><td align="left"><p>male</p></td><td align="left"><p>Italy</p></td><td align="left"><p>c.640T > C, p.C214R</p></td><td align="left"><p>exon5</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>2.41</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Persistent hypertriglyceridemia;</p></td></tr><tr><td align="left"><p>Joshi et al. (2014)</p></td><td align="left"><p>21</p></td><td align="left"><p>5 m</p></td><td align="left"><p>1.5y</p></td><td align="left"><p>female</p></td><td align="left"><p>America</p></td><td align="left"><p>c.686G > A, p.R229Q; Deletion > 1.85 kb at a different locus;</p></td><td align="left"><p>exon6</p></td><td align="left"><p>Hemizygous</p></td><td align="left"><p>Y</p></td><td align="left"><p>9.48</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Developmental retardation; vomiting</p></td></tr><tr><td align="left"><p>Matarazzo et al.(2020)</p></td><td align="left"><p>22</p></td><td align="left"><p>1y</p></td><td align="left"><p>16y</p></td><td align="left"><p>male</p></td><td align="left"><p>Russia</p></td><td align="left"><p>c.895G > A, p.G299R</p></td><td align="left"><p>exon7</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>11.49</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Persistent hypertriglyceridemia, fenofibrate treatment is effective</p></td></tr><tr><td align="left"><p>lin et al.(2021)</p></td><td align="left"><p>23</p></td><td align="left"><p>4 m</p></td><td align="left"><p>4y</p></td><td align="left"><p>female</p></td><td align="left"><p>China</p></td><td align="left"><p>c.454 C > T,p.Q152*</p></td><td align="left"><p>exon4</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>4.39</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Short in stature;</p></td></tr><tr><td align="left"><p>Wang et al.(2021)</p></td><td align="left"><p>24</p></td><td align="left"><p>1 m</p></td><td align="left"><p>13 m</p></td><td align="left"><p>female</p></td><td align="left"><p>China</p></td><td align="left"><p>c.901G > T,p.E301*; A short fragment heterozygous deficiency</p></td><td align="left"><p>exon7</p></td><td align="left"><p>Hemizygous</p></td><td align="left"><p>Y</p></td><td align="left"><p>6.36</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Persisted jaundice and hepatomegaly</p></td></tr><tr><td align="left"><p>Leo Polchar et al.(2022)</p></td><td align="left"><p>25</p></td><td align="left"><p>28 m</p></td><td align="left"><p>6y</p></td><td align="left"><p>female</p></td><td align="left"><p>South Asian</p></td><td align="left"><p>c.500G > A, p.G167D</p></td><td align="left"><p>exon4</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>8.9</p></td><td align="left"><p>Y</p></td><td align="left"><p>Y</p></td><td align="left"><p>Faltering growth, hepatomegaly and raised transaminases; consanguineous marriage</p></td></tr><tr><td align="left"><p>Pawan Kumar et al.(2021)</p></td><td align="left"><p>26</p></td><td align="left"><p>5 m</p></td><td align="left"><p>11 m</p></td><td align="left"><p>male</p></td><td align="left"><p>India</p></td><td align="left"><p>c.500G > A,</p><p>p.G167D</p></td><td align="left"><p>exon4</p></td><td align="left"><p>Homozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>NA</p></td><td align="left"><p>N</p></td><td align="left"><p>Y</p></td><td align="left"><p>Massive hepatomegaly and mild splenomegaly</p></td></tr><tr><td align="left"><p>Tesarova et al.(2021)</p></td><td align="left"><p>27–35</p></td><td align="left" rowspan="2"><p>2-17y</p></td><td align="left" rowspan="2"><p>NA</p></td><td align="left"><p>NA</p></td><td align="left"><p>Roma</p></td><td align="left"><p>c.895G > A, p.G299R</p></td><td align="left"><p>exon7</p></td><td align="left"><p>Homozygote</p></td><td align="left" rowspan="2"><p>Y</p></td><td align="left" rowspan="2"><p>2.13-12</p></td><td align="left" rowspan="2"><p>Y</p></td><td align="left" rowspan="2"><p>6 of 10 patients</p></td><td align="left" rowspan="2"><p>Early onset moderate to severe hepatomegaly (9 of 10 patients)</p></td></tr><tr><td align="left"><p>Tesarova et al.(2021)</p></td><td align="left"><p>36</p></td><td align="left"><p>male</p></td><td align="left"><p>Palestinian Arab</p></td><td align="left"><p>c.116G > A, p.Trp39*</p></td><td align="left"><p>exon2</p></td><td align="left"><p>Homozygote</p></td></tr></tbody></table> </ephtml> </p> <p>Abbreviations: AP- acute pancreatitis; m-months; y-years; NA-not informative; Y-yes; N-no</p> <p>In addition to the proband, only two other patients were followed up to adulthood (23 years old and 31 years old); all of them still showed persistently high TG levels. These two patients suffered from transient HTG in infancy; however, their TG levels improved without special treatment, and AP was not observed until adulthood. The proband was the oldest patient who consumed a high-fat diet and smoked heavily, thus presenting with persistent HTG and recurrent HTG-AP and is the first reported adult patient with HTG-AP. Six heterozygous parents were reported to suffer from HTG, fatty liver, or short stature as listed in Table 3. The monogenic variant may be a previously unrecognized risk factor of dyslipidemias.</p> <p>Table 3 Summary of the key clinical and genetic data of the 6 mentioned heterozygous parents with the <emph>GPD1</emph> variants</p> <p> <ephtml> <table frame="hsides" rules="groups"><thead><tr><th align="left"><p>Reference</p></th><th align="left"><p>Case</p></th><th align="left"><p>Relation</p></th><th align="left"><p>Age</p></th><th align="left"><p>Consanguineous</p></th><th align="left"><p>Country</p></th><th align="left"><p>GPD1 Variants</p></th><th align="left"><p>Location</p></th><th align="left"><p>Zygosity</p></th><th align="left"><p>Elevated TG</p></th><th align="left"><p>Clinical features</p></th></tr></thead><tbody><tr><td align="left"><p>Basel-Vanagaite et al. (2012)</p></td><td char="." align="char"><p>1</p></td><td align="left"><p>Mother of F2-II6</p></td><td align="left"><p>47y</p></td><td align="left"><p>NA</p></td><td align="left"><p>Israel</p></td><td align="left"><p>c.361-1G > C, p.I119fs*94</p></td><td align="left"><p>intron3</p></td><td align="left"><p>Heterozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>Fatty liver; obesity; normal liver enzymes; HTG</p></td></tr><tr><td align="left"><p>Li et al. (2017)</p></td><td char="." align="char"><p>2</p></td><td align="left"><p>The father</p></td><td align="left"><p>40y</p></td><td align="left"><p>N</p></td><td align="left"><p>China</p></td><td align="left"><p>c.220–2 A > G</p></td><td align="left"><p>Intron2</p></td><td align="left"><p>Heterozygote</p></td><td align="left"><p>N</p></td><td align="left"><p>Short in stature; (the height:160 cm, BMI:17.6),</p></td></tr><tr><td align="left"><p>Li et al. (2017)</p></td><td char="." align="char"><p>3</p></td><td align="left"><p>The mother</p></td><td align="left"><p>37y</p></td><td align="left"><p>N</p></td><td align="left"><p>China</p></td><td align="left"><p>c.820G > A,</p><p>p. A274T</p></td><td align="left"><p>exon6</p></td><td align="left"><p>Heterozygote</p></td><td align="left"><p>N</p></td><td align="left"><p>Short in stature; (the height:153 cm, BMI:27.8) Obesity</p></td></tr><tr><td align="left"><p>Dionisi-Vici et al. (2016)</p></td><td char="." align="char"><p>4</p></td><td align="left"><p>The father</p></td><td align="left"><p>NA</p></td><td align="left"><p>N</p></td><td align="left"><p>NA</p></td><td align="left"><p>c.361-1G > C, p.I119fs*94</p></td><td align="left"><p>intron3</p></td><td align="left"><p>Heterozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>Fatty liver</p></td></tr><tr><td align="left"><p>Dionisi-Vici et al. (2016)</p></td><td char="." align="char"><p>5</p></td><td align="left"><p>The mother of patient B</p></td><td align="left"><p>NA</p></td><td align="left"><p>N</p></td><td align="left"><p>NA</p></td><td align="left"><p>c.361-1G > C, p.I119fs*94</p></td><td align="left"><p>intron3</p></td><td align="left"><p>Heterozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>Fatty liver</p></td></tr><tr><td align="left"><p>Li et al. (2018)</p></td><td char="." align="char"><p>6</p></td><td align="left"><p>The father of patient B</p></td><td align="left"><p>NA</p></td><td align="left"><p>N</p></td><td align="left"><p>China</p></td><td align="left"><p>c.523 C > T,</p><p>p. Q175*</p></td><td align="left"><p>exon4</p></td><td align="left"><p>Heterozygote</p></td><td align="left"><p>Y</p></td><td align="left"><p>Obesity(BMI:31.3); Elevated liver enzymes</p></td></tr></tbody></table> </ephtml> </p> <p>Abbreviations: y-years; NA-not informative; Y-yes; N-no; BMI-body mass index</p> <hd id="AN0182467571-16">Discussion</hd> <p>In the present study, we reported the novel variant <emph>GPD1</emph> p.K327N in a Chinese adult male patient with recurrent HTG-AP, and in <emph>vivo</emph> and in <emph>vitro</emph> analyses revealed that the variant may exert a mild effect on GPD1 protein function. The patient's medical history revealed that each onset of AP was related to high-fat diet consumption and heavy smoking, as well as gene-environment interactions played a vital role in the pathogenicity of the variant. HTG is a polygenic disorder, it doesn't conform to the typical dominant inheritance pattern. Instead, it is a disease manifestation triggered by the intertwined and synergistic effects of genetic factors and external environmental factors. The HTG phenotype is regulated by the complex networks of multiple gene variation and secondary factors. Heterozygosity for this <emph>GPD1</emph> variant may have combined with high-fat diet and heavy smoking to trigger HTG and HTG-AP in the patient.</p> <p> <emph>GPD1</emph>, located on chromosome 12q13.12, encodes GDP1 and is a member of the NAD-dependent GPD family. GPD1 catalyzes the reversible conversion of DHAP and NADH to G3P and NAD + in the cytoplasm and participates in carbohydrate and lipid metabolism [[<reflink idref="bib22" id="ref22">22</reflink>], [<reflink idref="bib27" id="ref23">27</reflink>]]. Currently, the exact mechanism underlying HTG caused by <emph>GPD1</emph> deficiency remains unclear, and the mainstream theory suggests that the <emph>GPD1</emph> variant may increase the G3P amount available for TG synthesis in the liver by restricting the G3P-to-DHAP conversion when the body suffers an overabundance of calories; thus, increasing TG levels [[<reflink idref="bib15" id="ref24">15</reflink>]]. In <emph>vivo</emph> experiment has confirmed that this novel mutation <emph>GPD1</emph> p.K327N can lead to a decrease in protein expression levels resulting the restriction of G3P-to-DHAP conversion and an increase in TG levels.</p> <p>Previous studies reported 35 biallelic patients with the <emph>GPD1</emph> variant, characterized by transient infantile hypertriglyceridemia (HTGTI) and presented mild or moderate persisting HTG, abnormal liver function, and hepatic steatosis. The primary variant sites of the <emph>GPD1</emph> gene were missense variants, followed by splicing variants and nonsense variants. Part of the articles clarified the reasons for HTG caused by the biallelic or homozygous variants. Basel-Vanagaite et al. reported the splice-site homozygous variant in intro 3 (c.361-1G > C) creates a truncated protein of 213 residues and missing some major secondary structures and active sites [[<reflink idref="bib8" id="ref25">8</reflink>]]. While compound heterozygous missense variant in exon 6 (c.820G > A) and splicing variant in exon 3 (c.220–2 A > G) generated a decreased expression of the protein and the loss of bases [[<reflink idref="bib15" id="ref26">15</reflink>]]. Most of the reported patients were identified in infancy and presented long-term abnormal TG levels, only about 30.0% had returned to normal during follow-up. However, only two patients were followed up to adulthood (23 years old and 31 years old), who were accompanied by persistently high TG levels without HTG-AP onset. The fitting TG curve of these patients carrying the <emph>GPD1</emph> variant showed that HTG in early infants decreased rapidly with age, especially within 1 year of age. However, its average level exceeded the normal upper limit during the later period [[<reflink idref="bib28" id="ref27">28</reflink>]]. The characteristics of mild or moderate persisting HTG in some patients indicated that the influence of <emph>GPD1</emph> defect was a prolonged process rather than temporary, reflecting the persistent disorder in lipid metabolism, which may exert long-term adverse effects on health, as well as HTG may relapse in most patients.</p> <p>HTG is a polygenic disease, which may not be explained by a simple monogenic disease inheritance model. The HTG phenotype is regulated by a complex network of multiple gene variations and secondary factors. Previous studies have demonstrated that monogenic HTG in patients with severe HTG or HTGTI displays classic autosomal recessive hereditary disorders. Affected individuals are often homozygous or compound heterozygous for large-effect loss-off function variants in genes that regulate catabolism of TG-rich lipoproteins, such as <emph>LPL</emph>, <emph>APOC2</emph>, <emph>APOA5</emph>, <emph>LMF1</emph>, <emph>GPIHBP1</emph>, and <emph>GPD1</emph> [[<reflink idref="bib8" id="ref28">8</reflink>]]. Fasilaas et al. reported homozygous mutations of LPL lead to the onset of HTG in infancy [[<reflink idref="bib29" id="ref29">29</reflink>]], while heterozygous patients develop the disease in adulthood synergized with environmental factors [[<reflink idref="bib30" id="ref30">30</reflink>]]. Heterozygous mutations, which possess the potential to collaborate with environmental elements and subsequently trigger the onset of diseases, urgently demand the attention of clinicians. Gene-environment interactions are vital for the pathogenicity of many diseases, including HTG-AP. The heterozygous monogenic variant of <emph>GPD1</emph> may be a risk factor of dyslipidemias. The six related parents, who were identified as <emph>GPD1</emph> heterozygous carriers, suffered from HTG, fatty liver. Unlike the pathogenicity of frameshift, nonsense, or biallelic <emph>GPD1</emph> variants resulting in the complete or almost complete loss of function and leading to HTG, a heterozygous missense variant associated with a mild functional effect may be identified by clinicians if it synergistically interacts with other genetic and environmental factors [[<reflink idref="bib30" id="ref31">30</reflink>]]. The HTG phenotype is regulated by a complex network of multiple gene variations and secondary factors, and HTG-related diseases may be caused by a variable combination of genetic determinants and environmental factors present. The present functional analyses showed that <emph>GPD1</emph> p.K327N was a mild variant in terms of its functional effects.</p> <p>The proband was obese in the AP onset period, with a long history of high-fat diet consumption and heavy smoking. Additionally, the patient had been overeating and smoking excessively right before the onset of HTG-AP (Fig. 1). Tobacco can increase free fatty acid delivery into plasma by affecting lipid metabolism in the liver, thus inducing an increase in TG levels owing to the defective lipolytic system. Heavy smoking is correlated to plasma TG levels at the population level [[<reflink idref="bib32" id="ref32">32</reflink>]]; thus, the combination of high-fat diet consumption, heavy smoking, and underlying genetic risk factors for HTG may worsen or even trigger HTG-AP development. Additionally, specific triggers of HTG related to <emph>GPD1</emph> mutation cannot be excluded and should be identified in the future. It is impossible to trace back or determine whether the patient and his daughter have suffered HTGTI. The patient's daughter is 19 years old now and has a normal BMI and normal TG level, consuming a low-fat diet and avoiding cigarettes and alcohol. But as the variant carrier, she still needs close follow-up and has a relatively high probability of developing HTG over time as lack of GPD1 may interfere with the glycerol phosphate shuttle. Related expert panel advises that people aged 10–21 years with lipid abnormalities should be handled for 3–6 months with diet adjustments at least. A diet rich in low-fat medium-chain TG may be effective in some people for lowering TG levels [[<reflink idref="bib30" id="ref33">30</reflink>], [<reflink idref="bib33" id="ref34">33</reflink>]]. As the long-term effects of <emph>GPD1</emph> deficiency on transient HTG remain unclear, strengthening the long-term follow-up of these patients, maintaining a healthy lifestyle, avoiding alcohol and tobacco intake and paying attention to changes in lipid levels, liver functions, and pancreatitis are crucial.</p> <p>The proband, who consumed a high-fat diet and smoked heavily, carried a novel <emph>GPD1</emph> variant and thus was diagnosed with HTG. Furthermore, he suffered from repeated episodes of HTG-AP since adulthood (32 years old). The present patient is the first reported case of a <emph>GPD1</emph> heterozygous mutation carrier with recurrent HTG and HTG-AP in adulthood. Drug administration (fenofibrate), less smoking, and healthy diet consumption were effective in controlling HTG-AP attacks, indicating supervision on the patient's lifestyle have a significant impact on clinical outcomes. This result indicated that the missense variant associated with a mild functional effect may interact synergistically with other genetic and environmental factors to affect normal protein functions. The present study highlights the importance of screening <emph>GPD1</emph> in patients with recurrent HTG. Patients with recurrent HTG should be considered gene-screening and provided individualized lifestyle guidance. Additionally, the study shows that gene-environment interactions play a key role in the pathogenicity of the disease, thereby deepening the existing knowledge of this rare disorder, both concerning the phenotype and underlying molecular mechanism.</p> <hd id="AN0182467571-17">Conclusion</hd> <p>In conclusion, we reported a Chinese male adult patient with recurrent HTG-AP carrying a novel variant of <emph>GPD1</emph>, p.K327N (c.981G > C). It is the first reported case of a <emph>GPD1</emph> heterozygous mutation carrier with recurrent HTG and HTG-AP. The <emph>GPD1</emph> p.K327N missense variant exerted a mild effect on GPD1 secretion, highlighting an association of this variant with high-fat diet consumption and heavy smoking. In future clinical diagnosis, genetic screening should be considered for the presence of variants of HTG-related genes such as <emph>GPD1</emph> in patients with recurrent HTG-AP. The pathogenesis of <emph>GPD1</emph>-related diseases and gene-environment interactions associated with them need further clinical and basic medical research.</p> <hd id="AN0182467571-18">Author contributions</hd> <p>X.L., J.D. and W.Y. designed the study. X.L., B.Z. and X.L. identified the novel variants, performed the experiments. Y.H., M.C., K.C. and M.W. obtained the clinical data. X.L., X.C. and M.C. wrote the manuscript. J.D. and W.Y. critically revised the manuscript with important intellectual input. All authors reviewed the manuscript.</p> <hd id="AN0182467571-19">Funding</hd> <p>This work was supported by the National Natural Science Foundation of China (No.82302442), the fundings for Clinical Trials from the Affiliated Drum Tower Hospital, Medical School of Nanjing University(grant numbers 2021-LCYJ-PY-40).</p> <hd id="AN0182467571-20">Data availability</hd> <p>No datasets were generated or analysed during the current study.</p> <hd id="AN0182467571-21">Declarations</hd> <p></p> <hd id="AN0182467571-22">Ethics approval and consent to participate</hd> <p>The study was approved by the Ethics Committee of Nanjing Drum Tower Hospital (2021-370-02) and was conducted under the Declaration of Helsinki ethical principles for medical research involving human subjects. Informed consent was obtained from the children's parents. All participants provided both written and verbal consent to be part of this study.</p> <hd id="AN0182467571-23">Consent for publication</hd> <p>Written informed consent for publication of clinical details was obtained from the guardians of the patient.</p> <hd id="AN0182467571-24">Competing interests</hd> <p>The authors declare no competing interests.</p> <hd id="AN0182467571-25">Abbreviations</hd> <p></p> <p>• TG</p> <p></p> <ulist> <item> Triglyceride</item> <p></p> </ulist> <p>• HTG</p> <p></p> <ulist> <item> Hypertriglyceridemia</item> <p></p> </ulist> <p>• AP</p> <p></p> <ulist> <item> Acute pancreatitis</item> <p></p> </ulist> <p>• LPL</p> <p></p> <ulist> <item> Lipoprotein lipase</item> <p></p> </ulist> <p>• APOA5</p> <p></p> <ulist> <item> Apolipoprotein A-V</item> <p></p> </ulist> <p>• GPD1</p> <p></p> <ulist> <item> Glycerol-3-phosphate dehydrogenase 1</item> <p></p> </ulist> <p>• GPIHBP1</p> <p></p> <ulist> <item> Glycosylphosphatidylinositol-anchored high density lipoprotein-binding protein 1</item> <p></p> </ulist> <p>• LMF1</p> <p></p> <ulist> <item> Lipase maturation factor 1</item> <p></p> <item> HTG‑AP</item> <p></p> <item> Hypertriglyceridemia‑related acute pancreatitis</item> <p></p> </ulist> <p>• DNA</p> <p></p> <ulist> <item> Deoxyribonucleic acid</item> <p></p> </ulist> <p>• SAP</p> <p></p> <ulist> <item> Severe acute pancreatitis</item> <p></p> </ulist> <p>• APOC2</p> <p></p> <ulist> <item> Apolipoprotein C-II</item> <p></p> </ulist> <p>• DHAP</p> <p></p> <ulist> <item> Dihydroxyacetone phosphate</item> <p></p> </ulist> <p>• G3P</p> <p></p> <ulist> <item> Glycerol-3-phosphate</item> <p></p> </ulist> <p>• NADH</p> <p></p> <ulist> <item> Nicotine adenine dinucleotide</item> <p></p> </ulist> <p>• BMI</p> <p></p> <ulist> <item> Body mass index</item> <p></p> </ulist> <p>• PCR</p> <p></p> <ulist> <item> Polymerase chain reaction</item> <p></p> </ulist> <p>• TC</p> <p></p> <ulist> <item> Total cholesterol</item> <p></p> </ulist> <p>• HDL</p> <p></p> <ulist> <item> High density lipoprotein cholesterol</item> <p></p> </ulist> <p>• LDL</p> <p></p> <ulist> <item> Low density lipoprotein cholesterol</item> <p></p> </ulist> <p>• PCT</p> <p></p> <ulist> <item> Procalcitonin</item> <p></p> </ulist> <p>• CT</p> <p></p> <ulist> <item> Computed tomography</item> <p></p> </ulist> <p>• MAP</p> <p></p> <ulist> <item> Mild acute pancreatitis</item> <p></p> </ulist> <p>• HTGTI</p> <p></p> <ulist> <item> Transient infantile hypertriglyceridemia</item> <p></p> </ulist> <p>• NA</p> <p></p> <ulist> <item> Not informative</item> </ulist> <hd id="AN0182467571-26">Electronic supplementary material</hd> <p>Below is the link to the electronic supplementary material.</p> <p>Graph: Supplementary Material 1</p> <p>Graph: Supplementary Material 2</p> <hd id="AN0182467571-27">Publisher's note</hd> <p>Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.</p> <ref id="AN0182467571-28"> <title> References </title> <blist> <bibl id="bib1" idref="ref1" type="bt">1</bibl> <bibtext> Li X, Ke L, Dong J, Ye B, Meng L, Mao W. Significantly different clinical features between hypertriglyceridemia and biliary acute pancreatitis: a retrospective study of 730 patients from a tertiary center. BMC Gastroenterol. 2018; 18; 1: 89. 10.1186/s12876-018-0821-z. 29914404. 6007076</bibtext> </blist> <blist> <bibl id="bib2" idref="ref2" type="bt">2</bibl> <bibtext> Li X, Yang Q, Shi X, Chen W, Pu N, Li W. Compound but non-linked heterozygous p.W14X and p.L279 V LPL gene mutations in a Chinese patient with long-term severe hypertriglyceridemia and recurrent acute pancreatitis. Lipids Health Dis. 2018; 17; 1: 144. 10.1186/s12944-018-0789-2. 29921298. 6009947</bibtext> </blist> <blist> <bibl id="bib3" idref="ref3" type="bt">3</bibl> <bibtext> Chen WW, Yang Q, Li XY, Shi XL, Pu N, Lu GT. Identification of a novel and heterozygous LMF1 nonsense mutation in an acute pancreatitis patient with severe hypertriglyceridemia, severe obesity and heavy smoking. Lipids Health Dis. 2019; 18; 1: 68. 10.1186/s12944-019-1012-9. 30885219. 6421687</bibtext> </blist> <blist> <bibl id="bib4" idref="ref5" type="bt">4</bibl> <bibtext> Fortson MR, Freedman SN, Webster PD 3. Clinical assessment of hyperlipidemic pancreatitis. Am J Gastroenterol. 1995;90(12):2134–9.</bibtext> </blist> <blist> <bibl id="bib5" type="bt">5</bibl> <bibtext> Carr RA, Rejowski BJ, Cote GA, Pitt HA, Zyromski NJ. Systematic review of hypertriglyceridemia-induced acute pancreatitis: a more virulent etiology?. Pancreatology: Official J Int Association Pancreatology (IAP) [et al]. 2016; 16; 4: 469-76. 1:CAS:528:DC%2BC28XktVOls7s%3D. 10.1016/j.pan.2016.02.011</bibtext> </blist> <blist> <bibl id="bib6" idref="ref6" type="bt">6</bibl> <bibtext> Zheng Y, Zhou Z, Li H, Li J, Li A, Ma B. A multicenter study on etiology of acute pancreatitis in Beijing during 5 years. Pancreas. 2015; 44; 3: 409-14. 10.1097/MPA.0000000000000273. 25438072</bibtext> </blist> <blist> <bibl id="bib7" type="bt">7</bibl> <bibtext> Jin M, Bai X, Chen X, Zhang H, Lu B, Li Y. A 16-year trend of etiology in acute pancreatitis: the increasing proportion of hypertriglyceridemia-associated acute pancreatitis and its adverse effect on prognosis. J Clin Lipidol. 2019; 13; 6: 947-e953941. 10.1016/j.jacl.2019.09.005. 31735687</bibtext> </blist> <blist> <bibl id="bib8" idref="ref7" type="bt">8</bibl> <bibtext> Basel-Vanagaite L, Zevit N, Har Zahav A, Guo L, Parathath S, Pasmanik-Chor M. Transient infantile hypertriglyceridemia, fatty liver, and hepatic fibrosis caused by mutated GPD1, encoding glycerol-3-phosphate dehydrogenase 1. Am J Hum Genet. 2012; 90; 1: 49-60. 1:CAS:528:DC%2BC38XovFGgsQ%3D%3D. 10.1016/j.ajhg.2011.11.028. 22226083. 3257852</bibtext> </blist> <blist> <bibl id="bib9" idref="ref8" type="bt">9</bibl> <bibtext> Lek M, Karczewski KJ, Minikel EV, Samocha KE, Banks E, Fennell T. Analysis of protein-coding genetic variation in 60,706 humans. Nature. 2016; 536; 7616: 285-91. 1:CAS:528:DC%2BC28XhtlOnsbbP. 10.1038/nature19057. 27535533. 5018207</bibtext> </blist> <blist> <bibtext> Kopanos C, Tsiolkas V, Kouris A, Chapple CE, Albarca Aguilera M, Meyer R. VarSome: the human genomic variant search engine. Bioinf (Oxford England). 2019; 35; 11: 1978-80. 1:CAS:528:DC%2BB3cXhslOisLk%3D</bibtext> </blist> <blist> <bibtext> den Dunnen JT, Dalgleish R, Maglott DR, Hart RK, Greenblatt MS, McGowan-Jordan J. HGVS recommendations for the description of sequence variants: 2016 update. Hum Mutat. 2016; 37; 6: 564-9. 10.1002/humu.22981</bibtext> </blist> <blist> <bibtext> Williams JC, Kalyaanamoorthy S. PoseFilter: a PyMOL plugin for filtering and analyzing small molecule docking in symmetric binding sites. Bioinf (Oxford England). 2021; 37; 19: 3367-8. 1:CAS:528:DC%2BB38Xit1Cqsbw%3D</bibtext> </blist> <blist> <bibtext> Berglund L, Brunzell JD, Goldberg AC, Goldberg IJ, Sacks F, Murad MH. Evaluation and treatment of hypertriglyceridemia: an endocrine Society clinical practice guideline. J Clin Endocrinol Metab. 2012; 97; 9: 2969-89. 1:CAS:528:DC%2BC38XhtlymurbF. 10.1210/jc.2011-3213. 22962670. 3431581</bibtext> </blist> <blist> <bibtext> Dron JS, Wang J, McIntyre AD, Cao H, Hegele RA. The polygenic nature of mild-to-moderate hypertriglyceridemia. J Clin Lipidol. 2020; 14; 1: 28-e3422. 10.1016/j.jacl.2020.01.003. 32033914</bibtext> </blist> <blist> <bibtext> Li N, Chang G, Xu Y, Ding Y, Li G, Yu T. Biallelic mutations in GPD1 gene in a Chinese boy mainly presented with obesity, insulin resistance, fatty liver, and short stature. Am J Med Genet Part A. 2017; 173; 12: 3189-94. 1:CAS:528:DC%2BC2sXhvVWrsr3J. 10.1002/ajmg.a.38473. 28944580</bibtext> </blist> <blist> <bibtext> Li JQ, Xie XB, Feng JY, Chen L, Abuduxikuer K, Lu Y. A novel homozygous mutation in the glycerol-3-phosphate dehydrogenase 1 gene in a Chinese patient with transient infantile hypertriglyceridemia: a case report. BMC Gastroenterol. 2018; 18; 1: 96. 10.1186/s12876-018-0827-6. 29940878. 6020200</bibtext> </blist> <blist> <bibtext> Dionisi-Vici C, Shteyer E, Niceta M, Rizzo C, Pode-Shakked B, Chillemi G. Expanding the molecular diversity and phenotypic spectrum of glycerol 3-phosphate dehydrogenase 1 deficiency. J Inherit Metab Dis. 2016; 39; 5: 689-95. 1:CAS:528:DC%2BC28XhtFansbbJ. 10.1007/s10545-016-9956-7. 27368975</bibtext> </blist> <blist> <bibtext> Joshi M, Eagan J, Desai NK, Newton SA, Towne MC, Marinakis NS. A compound heterozygous mutation in GPD1 causes hepatomegaly, steatohepatitis, and hypertriglyceridemia. Eur J Hum Genetics: EJHG. 2014; 22; 10: 1229-32. 1:CAS:528:DC%2BC2cXjtVKjs7g%3D. 10.1038/ejhg.2014.8. 24549054</bibtext> </blist> <blist> <bibtext> Matarazzo L, Ragnoni V, Malaventura C, Leon A, Colavito D, Vigna GB. Successful fenofibrate therapy for severe and persistent hypertriglyceridemia in a boy with cirrhosis and glycerol-3-phosphate dehydrogenase 1 deficiency. JIMD Rep. 2020; 54; 1: 25-31. 32685347. 7358666</bibtext> </blist> <blist> <bibtext> Lin H, Fang Y, Han L, Chen J, Lou J, Yu J. Case Report: identification of a Novel homozygous mutation in GPD1 gene of a Chinese child with transient infantile hypertriglyceridemia. Front Genet. 2021; 12: 726116. 1:CAS:528:DC%2BB3MXisV2jtLzI. 10.3389/fgene.2021.726116. 34484308. 8416348</bibtext> </blist> <blist> <bibtext> Wang J, Sun F, Xu P, Zhang Y, Sun X, Deng H. Transient infantile hypertriglyceridemia with jaundice: a case report. Medicine. 2021; 100; 17: e25697. 10.1097/MD.0000000000025697. 33907148. 8084070</bibtext> </blist> <blist> <bibtext> Polchar L, Vallabhaneni P. Case of GPD1 deficiency causing hypertriglyceridaemia and non-alcoholic steatohepatitis. BMJ case Rep 2022, 15(4).</bibtext> </blist> <blist> <bibtext> Kumar P, Sharma S. Transient infantile hypertriglyceridemia and Hepatic Steatosis in an infant with GPD1 mutation. Indian J Pediatr. 2021; 88; 5: 495-6. 10.1007/s12098-021-03663-2. 33447932</bibtext> </blist> <blist> <bibtext> Tesarova M, Stranecky V, Konecna P, Prochazkova D, Hulkova H, Zeman J. GPD1 Deficiency - Underdiagnosed cause of Liver Disease. Indian J Pediatr. 2021; 88; 1: 80-1. 10.1007/s12098-020-03385-x. 32591995</bibtext> </blist> <blist> <bibtext> Xie XB, Li MP, Wang JS. [Transient infantile hypertriglyceridemia caused by GPD1 deficiency: report of two cases and literature review]. Zhonghua Er Ke Za Zhi. 2020; 58; 11: 923-7. 1:STN:280:DC%2BB3s7nvVaqtQ%3D%3D. 33120465</bibtext> </blist> <blist> <bibtext> Ma PF, Li WW, Chen L, Lu Y. [A case of transient infantile hypertriglyceridemia caused by mutations in the glycerol-3-phosphate dehydrogenase 1 gene]. Zhonghua Gan Zang Bing Za Zhi = Zhonghua ganzangbing zazhi = Chinese. J Hepatol. 2021; 29; 10: 1014-6. 1:STN:280:DC%2BB2cfmslSltw%3D%3D</bibtext> </blist> <blist> <bibtext> Ou X, Ji C, Han X, Zhao X, Li X, Mao Y. Crystal structures of human glycerol 3-phosphate dehydrogenase 1 (GPD1). J Mol Biol. 2006; 357; 3: 858-69. 1:CAS:528:DC%2BD28XisFyitL8%3D. 10.1016/j.jmb.2005.12.074. 16460752</bibtext> </blist> <blist> <bibtext> Wang J, Sun X, Jiao L, Xiao Z, Riaz F, Zhang Y. Clinical characteristics and variant analyses of transient infantile hypertriglyceridemia related to GPD1 gene. Front Genet. 2022; 13: 916672. 1:CAS:528:DC%2BB38XisVSqtbnE. 10.3389/fgene.2022.916672. 36051699. 9424621</bibtext> </blist> <blist> <bibtext> Kiyamudeen F, Rajapaksha M, Atapattu N, Kularatne SD, Schröder S, Hooper AJ. Homozygous LPL and GPIHBP1 variants causing familial chylomicronaemia syndrome in Sri Lankan children. Pathology. 2024; 56; 6: 904-6. 1:CAS:528:DC%2BB2cXht1Cqtr%2FF. 10.1016/j.pathol.2024.02.015. 38777740</bibtext> </blist> <blist> <bibtext> Hu Y, Zhang G, Yang Q, Pu N, Li K, Li B. The east asian-specific LPL p.Ala288Thr (c.862G > A) missense variant exerts a mild effect on protein function. Lipids Health Dis. 2023; 22; 1: 119. 1:CAS:528:DC%2BB3sXhslShsbrN. 10.1186/s12944-023-01875-3. 37550668. 10405562</bibtext> </blist> <blist> <bibtext> Pu N, Yang Q, Shi XL, Chen WW, Li XY, Zhang GF. Gene-environment interaction between APOA5 c.553G > T and pregnancy in hypertriglyceridemia-induced acute pancreatitis. J Clin Lipidol. 2020; 14; 4: 498-506. 10.1016/j.jacl.2020.05.003. 32561169</bibtext> </blist> <blist> <bibtext> Park S, Kang S, Alcohol. Carbohydrate, and Calcium intakes and Smoking interactions with APOA5 rs662799 and rs2266788 were Associated with elevated plasma triglyceride concentrations in a cross-sectional study of Korean adults. J Acad Nutr Dietetics. 2020; 120; 8: 1318-e13291311. 10.1016/j.jand.2020.01.009</bibtext> </blist> <blist> <bibtext> Expert panel on integrated guidelines for cardiovascular health. Risk reduction in children and adolescents: summary report. Pediatrics. 2011; 128; Suppl 5: S213-256</bibtext> </blist> </ref> <aug> <p>By Xiao-Yao Li; Bei-Yuan Zhang; Xin-Ran Liang; Yan-Yu Han; Min-Hua Cheng; Mei Wei; Ke Cao; Xian-Cheng Chen; Ming Chen; Jian-Feng Duan and Wen-Kui Yu</p> <p>Reported by Author; Author; Author; Author; Author; Author; Author; Author; Author; Author; Author</p> </aug> <nolink nlid="nl1" bibid="bib10" firstref="ref9"></nolink> <nolink nlid="nl2" bibid="bib11" firstref="ref10"></nolink> <nolink nlid="nl3" bibid="bib12" firstref="ref11"></nolink> <nolink nlid="nl4" bibid="bib13" firstref="ref12"></nolink> <nolink nlid="nl5" bibid="bib14" firstref="ref13"></nolink> <nolink nlid="nl6" bibid="bib15" firstref="ref15"></nolink> <nolink nlid="nl7" bibid="bib17" firstref="ref16"></nolink> <nolink nlid="nl8" bibid="bib19" firstref="ref17"></nolink> <nolink nlid="nl9" bibid="bib21" firstref="ref18"></nolink> <nolink nlid="nl10" bibid="bib23" firstref="ref19"></nolink> <nolink nlid="nl11" bibid="bib24" firstref="ref20"></nolink> <nolink nlid="nl12" bibid="bib25" firstref="ref21"></nolink> <nolink nlid="nl13" bibid="bib22" firstref="ref22"></nolink> <nolink nlid="nl14" bibid="bib27" firstref="ref23"></nolink> <nolink nlid="nl15" bibid="bib28" firstref="ref27"></nolink> <nolink nlid="nl16" bibid="bib29" firstref="ref29"></nolink> <nolink nlid="nl17" bibid="bib30" firstref="ref30"></nolink> <nolink nlid="nl18" bibid="bib32" firstref="ref32"></nolink> <nolink nlid="nl19" bibid="bib33" firstref="ref34"></nolink>
CustomLinks:
  – Url: https://resolver.ebsco.com/c/xy5jbn/result?sid=EBSCO:edsdoj&genre=article&issn=17558794&ISBN=&volume=18&issue=1&date=20250101&spage=1&pages=1-14&title=BMC Medical Genomics&atitle=Identification%20of%20a%20novel%20heterozygous%20GPD1%20missense%20variant%20in%20a%20Chinese%20adult%20patient%20with%20recurrent%20HTG-AP%20consuming%20a%20high-fat%20diet%20and%20heavy%20smoking&aulast=Xiao-Yao%20Li&id=DOI:10.1186/s12920-025-02088-6
    Name: Full Text Finder (for New FTF UI) (s8985755)
    Category: fullText
    Text: Find It @ SCU Libraries
    MouseOverText: Find It @ SCU Libraries
  – Url: https://doaj.org/article/c48d0c25282c417fb028903c66b84834
    Name: EDS - DOAJ (s8985755)
    Category: fullText
    Text: View record from DOAJ
    MouseOverText: View record from DOAJ
Header DbId: edsdoj
DbLabel: Directory of Open Access Journals
An: edsdoj.48d0c25282c417fb028903c66b84834
RelevancyScore: 1064
AccessLevel: 3
PubType: Academic Journal
PubTypeId: academicJournal
PreciseRelevancyScore: 1064.22692871094
IllustrationInfo
Items – Name: Title
  Label: Title
  Group: Ti
  Data: Identification of a novel heterozygous GPD1 missense variant in a Chinese adult patient with recurrent HTG-AP consuming a high-fat diet and heavy smoking
– Name: Author
  Label: Authors
  Group: Au
  Data: <searchLink fieldCode="AR" term="%22Xiao-Yao+Li%22">Xiao-Yao Li</searchLink><br /><searchLink fieldCode="AR" term="%22Bei-Yuan+Zhang%22">Bei-Yuan Zhang</searchLink><br /><searchLink fieldCode="AR" term="%22Xin-Ran+Liang%22">Xin-Ran Liang</searchLink><br /><searchLink fieldCode="AR" term="%22Yan-Yu+Han%22">Yan-Yu Han</searchLink><br /><searchLink fieldCode="AR" term="%22Min-Hua+Cheng%22">Min-Hua Cheng</searchLink><br /><searchLink fieldCode="AR" term="%22Mei+Wei%22">Mei Wei</searchLink><br /><searchLink fieldCode="AR" term="%22Ke+Cao%22">Ke Cao</searchLink><br /><searchLink fieldCode="AR" term="%22Xian-Cheng+Chen%22">Xian-Cheng Chen</searchLink><br /><searchLink fieldCode="AR" term="%22Ming+Chen%22">Ming Chen</searchLink><br /><searchLink fieldCode="AR" term="%22Jian-Feng+Duan%22">Jian-Feng Duan</searchLink><br /><searchLink fieldCode="AR" term="%22Wen-Kui+Yu%22">Wen-Kui Yu</searchLink>
– Name: TitleSource
  Label: Source
  Group: Src
  Data: BMC Medical Genomics, Vol 18, Iss 1, Pp 1-14 (2025)
– Name: Publisher
  Label: Publisher Information
  Group: PubInfo
  Data: BMC, 2025.
– Name: DatePubCY
  Label: Publication Year
  Group: Date
  Data: 2025
– Name: Subset
  Label: Collection
  Group: HoldingsInfo
  Data: LCC:Internal medicine<br />LCC:Genetics
– Name: Subject
  Label: Subject Terms
  Group: Su
  Data: <searchLink fieldCode="DE" term="%22Glycerol-3-phosphate+dehydrogenase+1%22">Glycerol-3-phosphate dehydrogenase 1</searchLink><br /><searchLink fieldCode="DE" term="%22Gene-environment+interaction%22">Gene-environment interaction</searchLink><br /><searchLink fieldCode="DE" term="%22Hypertriglyceridemia%22">Hypertriglyceridemia</searchLink><br /><searchLink fieldCode="DE" term="%22Missense+variant%22">Missense variant</searchLink><br /><searchLink fieldCode="DE" term="%22Hypertriglyceridemia-induced+acute+pancreatitis%22">Hypertriglyceridemia-induced acute pancreatitis</searchLink><br /><searchLink fieldCode="DE" term="%22Internal+medicine%22">Internal medicine</searchLink><br /><searchLink fieldCode="DE" term="%22RC31-1245%22">RC31-1245</searchLink><br /><searchLink fieldCode="DE" term="%22Genetics%22">Genetics</searchLink><br /><searchLink fieldCode="DE" term="%22QH426-470%22">QH426-470</searchLink>
– Name: Abstract
  Label: Description
  Group: Ab
  Data: Abstract Background Glycerol-3-phosphate dehydrogenase 1 (GPD1) gene defect can cause hypertriglyceridemia (HTG), which usually occurs in infants. The gene defect has rarely been reported in adult HTG patients. In the present study, we described the clinical and functional analyses of a novel GPD1 missense variant in a Chinese adult patient with recurrent hypertriglyceridemia‑related acute pancreatitis (HTG-AP), consuming a high-fat diet and smoking heavily. Methods Exome sequencing was used to analyze the DNA of the adult patient’s blood sample. It was found that there was a new variant of GPD1 gene-p.K327N, which was verified by gold standard-sanger sequencing method. In vitro, the corresponding plasmid was constructed and transfected into human renal HEK-293T cells, and GPD1 protein levels were detected. A biogenic analysis was performed to study the population frequency, conservation, and electric potential diagram of the new variant p.K327N. Finally, the previously reported GPD1 variants were sorted and their phenotypic relationships were compared. Results A novel heterozygous variant of GPD1, p.K327N (c.981G > C), was found in the proband. Furthermore, the patient’s daughter carried this variant, whereas his wife did not carry the variant. The proband with obesity suffered eight episodes of HTG-AP from the age of 36 years, and each onset of AP was correlated to high-fat diet consumption and heavy smoking. In vitro, this variant exerted a relatively mild effect on GPD1 functions, which were associated with its effect upon secretion (~ 25% of secretion decreased compared with that of the wild-type); thus, eventually impairing protein synthesis. Additionally, 36 patients with GPD1 variants found in previous studies showed significant transient HTG in infancy. The proband carrying the GDP1 variant was the first reported adult with recurrent HTG-AP. Conclusion We identified a novel GPD1 variant, p.K327N, in a Chinese adult male patient with recurrent HTG-AP. The variant probably exerted a mild effect on GPD1 functions. The heterozygosity of this GPD1 variant, in addition to high-fat diet consumption and heavy smoking, probably triggered HTG-AP in the patient.
– Name: TypeDocument
  Label: Document Type
  Group: TypDoc
  Data: article
– Name: Format
  Label: File Description
  Group: SrcInfo
  Data: electronic resource
– Name: Language
  Label: Language
  Group: Lang
  Data: English
– Name: ISSN
  Label: ISSN
  Group: ISSN
  Data: 1755-8794
– Name: NoteTitleSource
  Label: Relation
  Group: SrcInfo
  Data: https://doaj.org/toc/1755-8794
– Name: DOI
  Label: DOI
  Group: ID
  Data: 10.1186/s12920-025-02088-6
– Name: URL
  Label: Access URL
  Group: URL
  Data: <link linkTarget="URL" linkTerm="https://doaj.org/article/c48d0c25282c417fb028903c66b84834" linkWindow="_blank">https://doaj.org/article/c48d0c25282c417fb028903c66b84834</link>
– Name: AN
  Label: Accession Number
  Group: ID
  Data: edsdoj.48d0c25282c417fb028903c66b84834
PLink https://login.libproxy.scu.edu/login?url=https://search.ebscohost.com/login.aspx?direct=true&site=eds-live&scope=site&db=edsdoj&AN=edsdoj.48d0c25282c417fb028903c66b84834
RecordInfo BibRecord:
  BibEntity:
    Identifiers:
      – Type: doi
        Value: 10.1186/s12920-025-02088-6
    Languages:
      – Text: English
    PhysicalDescription:
      Pagination:
        PageCount: 14
        StartPage: 1
    Subjects:
      – SubjectFull: Glycerol-3-phosphate dehydrogenase 1
        Type: general
      – SubjectFull: Gene-environment interaction
        Type: general
      – SubjectFull: Hypertriglyceridemia
        Type: general
      – SubjectFull: Missense variant
        Type: general
      – SubjectFull: Hypertriglyceridemia-induced acute pancreatitis
        Type: general
      – SubjectFull: Internal medicine
        Type: general
      – SubjectFull: RC31-1245
        Type: general
      – SubjectFull: Genetics
        Type: general
      – SubjectFull: QH426-470
        Type: general
    Titles:
      – TitleFull: Identification of a novel heterozygous GPD1 missense variant in a Chinese adult patient with recurrent HTG-AP consuming a high-fat diet and heavy smoking
        Type: main
  BibRelationships:
    HasContributorRelationships:
      – PersonEntity:
          Name:
            NameFull: Xiao-Yao Li
      – PersonEntity:
          Name:
            NameFull: Bei-Yuan Zhang
      – PersonEntity:
          Name:
            NameFull: Xin-Ran Liang
      – PersonEntity:
          Name:
            NameFull: Yan-Yu Han
      – PersonEntity:
          Name:
            NameFull: Min-Hua Cheng
      – PersonEntity:
          Name:
            NameFull: Mei Wei
      – PersonEntity:
          Name:
            NameFull: Ke Cao
      – PersonEntity:
          Name:
            NameFull: Xian-Cheng Chen
      – PersonEntity:
          Name:
            NameFull: Ming Chen
      – PersonEntity:
          Name:
            NameFull: Jian-Feng Duan
      – PersonEntity:
          Name:
            NameFull: Wen-Kui Yu
    IsPartOfRelationships:
      – BibEntity:
          Dates:
            – D: 01
              M: 01
              Type: published
              Y: 2025
          Identifiers:
            – Type: issn-print
              Value: 17558794
          Numbering:
            – Type: volume
              Value: 18
            – Type: issue
              Value: 1
          Titles:
            – TitleFull: BMC Medical Genomics
              Type: main
ResultId 1