Academic Journal
View in EDS
PDF Full Text
HTML Full Text

NID1 promotes laryngeal cancer stemness via activating WNT pathway

Bibliographic Details
Title: NID1 promotes laryngeal cancer stemness via activating WNT pathway
Authors: Wenlin Liu, Jie Wu, Yuanpu Lai, Siyi Zhang, Ankui Yang, Yixuan Li, Cuifang Chen, Zhongming Lu
Source: Biology Direct, Vol 19, Iss 1, Pp 1-11 (2024)
Publisher Information: BMC, 2024.
Publication Year: 2024
Collection: LCC:Biology (General)
Subject Terms: NID1, Laryngeal cancer, Radiotherapy resistance, WNT pathway, Cancer stem cells, Biology (General), QH301-705.5
More Details: Abstract Background Laryngeal cancer (LCA) is one of the most common head and neck squamous cell carcinoma with poor outcome. LCA stem cells are the main reason for LCA therapy resistance and relapse. Understanding the molecular mechanisms of the self-renew of LCA stem cells is critical to develop now targets and strategies for LCA therapy. Methods Q-PCR and western blotting assays were used to determine NID1 level in LCA tissues and normal laryngeal tissues. MTT, colony formation assay, apoptosis assay and animal model were used to investigate the effect of NID1 on radiotherapy resistance. Side population assay and sphere formation assay were used to determine the role of LCA in the self-renew of LCA stem cells. Results NID1 was upregulated in LCA tissues, particularly in LCA tissues derived from relapsed patients, and associated with had poor outcome. NID1 knockdown suppressed radiotherapy resistance and the self-renew of LCA stem cells, while NID1 overexpression promoted radiotherapy resistance and the self-renew of LCA stem cells. Further analysis showed that NID1 promotes radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway. Moreover, NID1 level was positively correlated with nuclear β-Catenin level in LCA tissues. Conclusion Our results show that NID1 promotes radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway, providing a novel potential target for LCA treatment.
Document Type: article
File Description: electronic resource
Language: English
ISSN: 1745-6150
50563718
Relation: https://doaj.org/toc/1745-6150
DOI: 10.1186/s13062-024-00548-0
Access URL: https://doaj.org/article/0f505637185844af98c4023ce0b8991d
Accession Number: edsdoj.0f505637185844af98c4023ce0b8991d
Database: Directory of Open Access Journals
Full text is not displayed to guests.
FullText Links:
  – Type: pdflink
    Url: https://content.ebscohost.com/cds/retrieve?content=AQICAHjPtM4BHU3ZchRwgzYmadcigk49r9CVlbU7V5F6lgH7WwFWkjbL3ZGxWipYiR2AGrLzAAAA4jCB3wYJKoZIhvcNAQcGoIHRMIHOAgEAMIHIBgkqhkiG9w0BBwEwHgYJYIZIAWUDBAEuMBEEDDxSO50-x9j_GuEDbwIBEICBmk2KOxeDDu_0_42VoBaevHh-DUXMnR3WlN8J0L6J61aWbMRBf-y92rL_yO_aocSpd_1NToi5uQ9XgdpFrKQmGFwNpLtCL_D_LbuwILGyssVKV9_kH1P-T_G0oghEIenmV2B_tQ6i3Ayjuo07OZphOOvISOPtFCMFpJW4SbCuG9fCkB5Ir8F52M8IzHhWK7CR-574HPb6lomSP5E=
Text:
  Availability: 1
  Value: <anid>AN0180904677;[38ly]13nov.24;2024Nov18.04:43;v2.2.500</anid> <title id="AN0180904677-1">NID1 promotes laryngeal cancer stemness via activating WNT pathway </title> <p>Background: Laryngeal cancer (LCA) is one of the most common head and neck squamous cell carcinoma with poor outcome. LCA stem cells are the main reason for LCA therapy resistance and relapse. Understanding the molecular mechanisms of the self-renew of LCA stem cells is critical to develop now targets and strategies for LCA therapy. Methods: Q-PCR and western blotting assays were used to determine NID1 level in LCA tissues and normal laryngeal tissues. MTT, colony formation assay, apoptosis assay and animal model were used to investigate the effect of NID1 on radiotherapy resistance. Side population assay and sphere formation assay were used to determine the role of LCA in the self-renew of LCA stem cells. Results: NID1 was upregulated in LCA tissues, particularly in LCA tissues derived from relapsed patients, and associated with had poor outcome. NID1 knockdown suppressed radiotherapy resistance and the self-renew of LCA stem cells, while NID1 overexpression promoted radiotherapy resistance and the self-renew of LCA stem cells. Further analysis showed that NID1 promotes radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway. Moreover, NID1 level was positively correlated with nuclear β-Catenin level in LCA tissues. Conclusion: Our results show that NID1 promotes radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway, providing a novel potential target for LCA treatment.</p> <p>Keywords: NID1; Laryngeal cancer; Radiotherapy resistance; WNT pathway; Cancer stem cells</p> <p>Wenlin Liu and Jie Wu contributed equally to this work.</p> <hd id="AN0180904677-2">Introduction</hd> <p>Laryngeal cancer (LCA) is one of the most common head and neck squamous cell carcinoma (HNSCC). Laryngeal surgery, radiotherapy, chemotherapy, and immunotherapy have been used to treat LCA. However, their curative effect still is limited, and the 5-year survival rate is below 40% [[<reflink idref="bib1" id="ref1">1</reflink>]]. Cancer stem cells (CSCs) which are a subpopulation cells containing in multiple kinds of tumors characterized with self-renewal ability. CSCs are the main reasons for tumor recurrence, metastasis, therapeutic resistance of radiotherapy and chemotherapy [[<reflink idref="bib3" id="ref2">3</reflink>]]. Many studies demonstrated that LCA CSCs play critical role in LCA recurrence, metastasis, and therapeutic resistance. Side population, CD24, ALDH, and CD133 have been used to identify and sort LCA CSCs [[<reflink idref="bib4" id="ref3">4</reflink>]]. Exploring the key genes and molecule mechanisms of regulating the self-renew of LCA stem cells will provide potential targets for developing LCA therapeutic strategies. Although some genes have been found to regulate LCA stem cells self-renews, such as PLOD2 [[<reflink idref="bib5" id="ref4">5</reflink>]], BMI1 [[<reflink idref="bib6" id="ref5">6</reflink>]], and DGCR5 [[<reflink idref="bib7" id="ref6">7</reflink>]]. However, the LCA CSCs regulating genes, and their molecular mechanisms are largely unknown.</p> <p>Nidogen-1 (NID1) is a secreted protein and regulates tumor-stroma crosstalk during tumor metastasis and has been demonstrated to regulate various tumors progression. NID1 has been demonstrated to promote lung metastasis of HCC, colorectal cancer, breast cancer, and melanoma via multiple molecular mechanisms [[<reflink idref="bib8" id="ref7">8</reflink>]–[<reflink idref="bib10" id="ref8">10</reflink>]]. However, the role and molecular mechanisms of NID1 regulating LCA therapeutic resistance and the self-renew of LCA stem cells have not been studied. Here, we found NID1 was overexpressed in relapsed LCA tissues and associated with poor outcome of LCA patients. Furthermore, NID1 promotes LCA radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway. We provided novel potential target for LCA treatment.</p> <hd id="AN0180904677-3">Materials and methods</hd> <p></p> <hd id="AN0180904677-4">Cell culture</hd> <p>LCA cell lines FaDu, Hep-2, TU212 and TU686 were purchased from ATCC (Manassa, VA, USA) and cultured using DMEM medium supplemented with 10% fetal bovine serum (FBS, F103-01, Vazyme, Nanjing, China). Human hypopharyngeal normal primary cell was cultured using human hypopharyngeal normal primary cell medium (M36074-04 S, Celprogen, CA, USA). These cells were maintained in a humidified incubator at 37 ℃ with 5% CO<subs>2</subs>. For radiotherapy resistance assay, LCA cells were seeded at 96 or 6-well plates, and irradiated with a linear accelerator dose of 0, 2, 4, 6, 8–10 Gy.</p> <hd id="AN0180904677-5">Tissues samples</hd> <p>This study was approved by the Ethics Committee of Guangdong Provincial People's Hospital. Written informed consent was obtained from all patients and all samples were collected according to the informed consent. The detailed Ten pairs of LCA tissues and adjacent normal tissues were collected. In addition, we collected 80 LCA tissues to determine the correlation between NID1 level and LCA patients' prognosis. The detailed information was shown in Supplementary Table 1.</p> <hd id="AN0180904677-6">Vectors and stable cell lines construction</hd> <p>To knockdown NID1, we subcloned the shRNAs sequence into the lentivirus PLKO.1-Puro (Addgene, #8543). The target sequences were shown as follows: shNID#1: 5' GCAGTCTACGTCACCACAAAT 3'; shNID#2: 5' CCAGAAGGTATCGCTGTTGAT3'; shTCF4#1: 5' CGAATTGAAGATCGTTTAGAA3'; shTCF4#2: 5' GAAAGGAATCTGAATCCGAAA 3'; shLEF#1: 5' GCACGGAAAGAAAGACAGCTA 3'; shLEF#2: 5' CCATCAGATGTCAACTCCAAA3'. To overexpress NID1, we subcloned the CDS sequence of NID1 into the lentivirus vector pCDH-CMV-Pur. To construct the stable cell line. We packaged the lentivirus via co-transfecting the transfer vectors with pMD2.G and psPAX2 into 293T cells using Lipofectamine 2000 (11668019, Thermo, Waltham, MA, USA). The lentivirus supernatant was collected at 48 h and 72 h after transfection, and infected interesting LCA cell line. Puromycin (T19978, TargetMol, Boston, MA, USA) was used to screen stable cell lines.</p> <hd id="AN0180904677-7">Q-PCR</hd> <p>Total RNA was isolated from cells using FreeZol Reagent (R711-02, Vazymes, Nanjing, China). RNA reverse transcription was performed using HiScript III RT SuperMix for qPCR (R323, Vazyme, Nanjing, China). Q-PCR was carried out using ChanQ Blue Universal SYBR qPCR Master Mix (Q312, Vazyme, Nanjing, China) on a LightCycler 480 Real-Time PCR System (Roche, Rotkreuz, Switzerland). The relative mRNA levels were calculated using 2<sups>-ΔΔCt</sups> method. <emph>GAPDH</emph> was used as the internal control. All experiments were carried out in triplicate. The primer sequences for Q-PCR were shown as follows: <emph>NID1</emph>, Forward: 5' ACTCCAGGCTCTTTCACGTG3'; Reverse: 5' GAATGTGTTCTCGCTCGTGC3'. <emph>MYC</emph>, Forward: 5' CATCAGCACAACTACGCAGC3', Reverse: 5' CGTTGTGTGTTCGCCTCTTG3'. <emph>CD44</emph>, Forward: 5' GAGCAGCACTTCAGGAGGTT3"; Reverse: 5' CTGTCTGTGCTGTCGGTGAT3'. <emph>SNAI1</emph>, Forward: 5' ATGAGGACAGTGGGAAAGGC3"; Reverse: 5' ATCCTTGGCCTCAGAGAGCT3'. <emph>RUNX2</emph>, Forward: 5' CAGCCTCTTCAGCACAGTGA3"; Reverse: 5' CTCACGTCGCTCATTTTGCC3'. <emph>CCND1</emph>, Forward: 5' GAGCTGCTCCTGGTGAACAA3'; Reverse: 5' TGTTTGTTCTCCTCCGCCTC3'.</p> <hd id="AN0180904677-8">Western blot</hd> <p>Total proteins were extracted from cells or tissues by RIPA Lysis and Extraction Buffer (89900, Thermo, Waltham, MA, USA) supplemented with protease inhibitor cocktail (HY-K0011, MCE. NJ, USA). Protein concentration was determined by BCA Protein Assay Kit (23225, Thermo, Waltham, MA, USA). Equal amounts of protein were separated by SDS-PAGE and transferred to PVDF membrane. The membranes were blocked by 5% nonfat milk and incubated with primary antibodies for overnight at 4℃. After washing with TBST for three times, the membranes were incubated with HRP-conjunct secondary antibodies. After washing with TBST buffer, signals were detected by enhanced chemiluminescence. Antibodies that were used are the following: anti-NID1 antibody (MA5-23911, Thermo, Waltham, MA, USA), anti-cleaved Caspase-3 (ab2302, Abcam, Cambridge, UK), Cleaved PARP (ab32064, Abcam, Cambridge, UK), KLF4 (ab215036, Abcam, Cambridge, UK), OCT4 (ab181557, Abcam, Cambridge, UK), SOX2 (ab97959, Abcam, Cambridge, UK), NANOG (ab109250, Abcam, Cambridge, UK), β-Catenin (ab32572, Abcam, Cambridge, UK), EF1α (05-235, Merck, Darmstadt, Germany) and GAPDH (ab8245, Abcam, Cambridge, UK).</p> <hd id="AN0180904677-9">Immunofluorescence (IF)</hd> <p>Cells were fixed with 4% paraformaldehyde for 30 min at room temperature and permeabilized for 2 h at room temperature. Then cells were incubated with primary antibodies for overnight at 4℃. After washing with 2% FBS, cells were incubated with secondary antibodies conjugate with Alexa Fluor 488. The nuclei were stained with DAPI. The images were captured under a fluorescence microscope.</p> <hd id="AN0180904677-10">Apoptosis assay</hd> <p>LCA cells were seeded at 6-well plates and irradiated with a linear accelerator dose of 4 Gy. Then cells were digested into single cells using 0.25% trypsin (25200072, Thermo, Waltham, MA, USA) and performed apoptosis assay using PE Annexin V apoptosis Detection Kit with 7-AAD (640934, Biolegend, San Diego, CA, USA) according to the manufacturer's protocol.</p> <hd id="AN0180904677-11">MTT assay</hd> <p>For cell viability assay, LCA cells were seeded at 96-well plates and irradiated with a linear accelerator dose of 0, 2, 4, 6, 8, 10 Gy. The MTT was added to each well and incubated with cells for 4 h. Then, the supernatant was removed, DMSO was added to dissolve the precipitate. Absorbance was determined by a spectrophotometer at 490 nm.</p> <hd id="AN0180904677-12">Colony formation assay</hd> <p>LCA cells were seeded at 6-well plates and irradiated with a linear accelerator dose of 4 Gy. 10 days after the treatment, cells were fixed with 4% paraformaldehyde, stained with 1% crystal violet, and photographed.</p> <hd id="AN0180904677-13">10 side population (SP) assay</hd> <p>Cells were dissociated into single cells using 0.25% trypsin and resuspended using 2% FBS. Subsequently, Hoechst 33,342 dye (HY-15559 A, MCE, NJ, USA) was added and incubated with cells for 90 min under shaking in 37℃. The control cells were incubated with 50µM verapamil (T20656, TargetMol, Boston, MA, USA) for 15 min at 37℃ before addition of Hoechst 33,342 dye. The percentage of Hoechst 33,342-labeled cells were analyzed using a flow cytometer (Cytek Aurora, Cytek, Fremont, CA, USA). SP cells were visualized by red vs. blue ultraviolet channels in linear mode.</p> <hd id="AN0180904677-14">Sphere formation assay</hd> <p>Cells were dissociated into single cells using 0.25% trypsin and seeded in 6-well ultralow attachment culture plates. Cells were cultured by DMEM/F12 medium supplemented with 2% B-27 (17504044, Thermo, Waltham, MA, USA), 0.4% BSA (A8010, Solarbio, Beijing, China), 20ng/ml bFGF (C046, Novoprotein, Shanghai, China), 20ng/ml EGF (C029, Novoprotein, Shanghai, China), 6 µg/ml Insulin (91077 C, Merch, Darmstadt, Germany) for 15 days. The numbers of spheres were counted under a microscope.</p> <hd id="AN0180904677-15">Animal model</hd> <p>5–6 weeks old male nude mice were purchased from Shanghai Model Organisms (Shanghai, China). All animal experiments were approved by the Ethical Committee of Guangdong Provincial People's Hospital. Hep2 cells with NID1 overexpression or knockdown were injected into the abdominal cavity of nude mice. Ten days after injection, mice treated with radiotherapy at a dose of 20 Gy. 20 days after radiotherapy treatment, the tumors were sacrificed. Tumors were photographed and weighed. Proteins were extracted from tumor tissues for WB assay.</p> <hd id="AN0180904677-16">Statistical analysis</hd> <p>The statistical analysis was performed using SPSS 20.0 (IBM, NY, USA) and GraphPad Prism software (GraphPad Software, Boston, MA, USA). All experiments were independently repeated at least times and data are shown as the mean ± SD. Student's t test was carried out to compare two groups. Kaplan-Meier curves and the log-rank test were performed survival analysis. GSEA was analyzed using online algorithm (https://<ulink href="http://www.gsea-msigdb.org/gsea/index.jsp">www.gsea-msigdb.org/gsea/index.jsp</ulink>). <emph>p</emph> < 0.05 indicated significant significance。 *<emph>p</emph> < 0.05, **<emph>p</emph> < 0.01, ***<emph>p</emph> < 0.0001.</p> <hd id="AN0180904677-17">Results</hd> <p></p> <hd id="AN0180904677-18">NID1 is elevated in LCA tissues and associated with poor outcome</hd> <p>To determine the role of NID1 in LCA therapeutic resistance and stem cell self-renew, we firstly determined NID1 levels in normal throat tissues and LCA tissues with/without recurrence using TCGA database and GSE27020. GSE27020 contains gene expression files of LCA tissues collected from 50 patients [[<reflink idref="bib11" id="ref9">11</reflink>]]. We found that NID1 was significantly upregulated in LCA tissues according to the TCGA database (Supplementary Fig. 1A). it also regulated in LCA tissues collected from patients with recurrence compared to those from patients without recurrence (Supplementary Fig. 1B). Then we integrated the TCGA database and GSE27020, and also found NID1 was significantly upregulated in LCA tissues with recurrence (Fig. 1A). Next, we determined NID1 level in LCA tissues and adjacent normal tissues (ANT). NID1 was elevated in LCA tissues both in mRNA and protein levels (Fig. 1B). We also determined NID1 expression in LCA cells and normal throat cells. Q-PCR and WB assay showed NID1 was significantly elevated in LCA cells (Fig. 1C). Importantly, Q-PCR and WB assay also demonstrated that NID1 was upregulated in LCA tissues with recurrence (Fig. 1D).</p> <p>Graph: Fig. 1 NID1 is upregulated in LCA tissues, particularly in LCA tissues derived from relapsed patients. (A) NID1 was upregulated in LCA tissues, particularly in LCA tissues derived from relapsed patients. (B) Q-PCR and western blotting assays showed that NID1 was upregulated in LCA tissues (T) compared to the adjacent normal tissues (ANT). (C) Q-PCR and western blotting assays showed that NID1 was upregulated in the LCA cells. (D) Q-PCR and western blotting assays showed that NID1 was upregulated in LCA tissues derived from relapsed patients compared to the non- relapsed patients. Data represents the mean ± SD, *p < 0.05</p> <p>Then, we determined the correlation between NID1 level and survival time of LCA patients. Kaplan-Meier analysis showed that patients with high NID1 level has shorter overall survival time or recurrence free survival time than those with low NID1 level (Fig. 2A). To confirm above results, we collected 80 LCA tissues. Kaplan-Meier analysis demonstrated that LCA patients with low NID1 level has longer overall survival time than those with high NID1 expression (Fig. 2B), Statistical analysis also showed NID1 was significantly highly expressed in tissues collected from relapsed LCA patients (Fig. 2B). Interestingly, we also found that NID1 was significantly upregulated in tissued collected from relapsed LCA patients compared to tissues collected from LCA patients without relapse among patients treated with radiotherapy after surgery, suggesting NID1 is associated with radiotherapy resistance (Supplementary Fig. 1C). GSEA analysis also showed that high NID1 expression was associated with LCA recurrence (Supplementary Fig. 1C). Together, these results show that NID1 is upregulated in LCA tissues and associated with LCA recurrence. NID1 might regulate radiotherapy resistance.</p> <p>Graph: Fig. 2 NID1 is associated with poor outcome of LCA patients. (A) Kaplan-Meier analysis for overall survival, and recurrence free survival based on the expression of NID1. Data were come from TCGA, GSE27020 and GSE25727 databases. (B) Kaplan-Meier analysis for overall survival based on the expression of NID1. (C) The proportion of low NID1 or high NID1 level in LCA patients with or without Recurrence. Data represents the mean ± SD, ***p < 0.001</p> <hd id="AN0180904677-19">NID1 increases the radiotherapy resistance of laryngeal cancer</hd> <p>To investigate the effect of NID1 on radiotherapy resistance, we downregulated or overexpressed NID1 in HEp-2 and TU212. Q-PCR and WB assay showed that NID1 confirmed that shRNAs against NID1 effectively inhibited NID1 expression and NID1 was significantly overexpressed in LCA cells infected with lentivirus containing NID1 overexpressing vector (Fig. 2A). Cell viability, colony formation and apoptosis assays showed that NID1 overexpression significantly increased radiotherapy resistance of LCA cells, while NID1 knockdown effectively inhibited radiotherapy resistance of LCA cells (Fig. 3B and D). We used a mouse model to confirm these results, we injected Hep2 cells with NID1 overexpression or knockdown into the abdominal cavity of nude mice. Ten days after injection, mice treated with radiotherapy at a dose of 20 Gy. 20 days after radiotherapy treatment, the tumors were sacrificed (Fig. 4A). We found that radiotherapy treatment didn't reduce the size and weight of xenograft tumor with NID1 overexpression, while radiotherapy treatment could reduce the size and weight of xenograft tumor with NID1 knockdown (Fig. 4B and C). In addition, we determined the level of Cleaved Caspase-3 and Cleaved PARP in xenograft tumors. WB assay suggested that NID1 overexpression reduced their expression, while NID1 knockdown increased their expression (Fig. 4D). IHC staining also confirmed that NID1 overexpression enhanced β-Catenin level, while NID1 knockdown reduced β-Catenin level in xenograft tumors (Fig. 4E). These results demonstrate that NID1 inhibits the sensitivity of radiotherapy treatment for LCA.</p> <p>Graph: Fig. 3 NID1 promotes radiotherapy resistance in vitro. (A) Q-PCR and western blotting assays of the effect of NID1 shRNAs and overexpression vector. (B) Cell viability assay for the effect of NID1 knockdown or overexpression on radiotherapy. (C) Colony formation assay for the effect of NID1 knockdown or overexpression on radiotherapy. (D) Apoptosis assay for the effect of NID1 knockdown or overexpression on radiotherapy. Data represents the mean ± SD, *p < 0.05. **p < 0.01</p> <p>Graph: Fig. 4 NID1 promotes radiotherapy resistance in vivo. (A) The schematic diagram for determining the effect of NID1 on radiotherapy using animal model. (B) The tumor sizes of xenograft tumor after radiotherapy treatment. (C) The tumor weights of xenograft tumor after radiotherapy treatment. (D) WB assay for the expression of Cleaved Caspase-3 and Cleaved RARP in tissues derived from xenograft tumor after radiotherapy treatment. (E) IHC staining assay for NID1 and β-Catenin in xenograft tumors. Scale bars, 60µM. Data represents the mean ± SD, **p < 0.01</p> <hd id="AN0180904677-20">NID1 promotes the self-renew of laryngeal cancer stem cells</hd> <p>Cancer stem cells are the main reason for therapeutic resistance. We have found that NID1 promotes the resistance of radiotherapy for LCA, suggesting that NID1 might regulate LCA stem cells. To verify this hypothesis, we used side population and sphere formation assays to investigate the role of NID1 in the self-renew of LCA CSCs. Side population assay showed that NID1 overexpression increased the proportion of side population, while NID1 knockdown reduced the proportion of side population (Fig. 5A and Supplementary Fig. 1E). In addition, sphere formation assay showed that NID1 overexpression promoted sphere formation, while NID1 knockdown inhibited sphere formation (Fig. 5B). To confirm above results, we performed WB assay to investigate the effect of NID1 expression on the stemness factors and found NID1 overexpression increased KLF4, OCT4, SOX2 and NANOG expression, while NID1 knockdown inhibited their expression (Fig. 5C). GSEA assay also showed NID1 expression was significantly positively correlated with stemness (Fig. 5D). Together, these results show that NID1 promotes radiotherapy the self-renew of LCA stem cells.</p> <p>Graph: Fig. 5 NID1 promotes the self-renew of LCA stem cells. (A) Side populations assay for the effect of NID1 knockdown or overexpression on the self-renew of LCA stem cells. (B) Sphere formation assay for the effect of NID1 knockdown or overexpression on the self-renew of LCA stem cells. (C) WB assay for the expression of KLF4, OCT4, SOX2 and NANOG in LCA cells with NID1 knockdown or overexpression. (D) GSEA assay for the relation between NID1 expression and stem cell regulating genes. Data represents the mean ± SD, *p < 0.05. **p < 0.01</p> <hd id="AN0180904677-21">NID1 promotes radiotherapy resistance and the self-renew of LCA stem cells via activating WNT...</hd> <p>To determine the regulatory mechanisms of NID1 promoting radiotherapy resistance and the self-renew of LCA stem cells, we found that NID1 level was positive correlation with WNT pathway activity (Fig. 6A). TOP/FOR luciferase reporter assay suggested that NID1 overexpression significantly promoted the luciferase activity, while NID1 knockdown significantly reduced the luciferase activity (Fig. 6B). WB and IF assays showed that NID1 overexpression promoted the β-Catenin nuclear translocation, while NID1 knockdown inhibited the nuclear translocation of β-Catenin (Fig. 5C and D). We also determined the expression of target genes of WNT pathway upon NID1 overexpression or knockdown. We found NID1 overexpression increased <emph>MYC</emph>,<emph> CD44</emph>,<emph> SNAI1</emph>,<emph> RUNX2</emph> and <emph>CCND1</emph> expression, while NID1 knockdown inhibited their expression (Fig. 6E), confirming NID1 regulates WNT pathway.</p> <p>Graph: Fig. 6 NID1 activates WNT pathway. (A) GSEA assay for the relation between NID1 expression and WNT pathway. (B) Luciferase reporter assay for the effect of NID1 on WNT pathway activation. (C) WB assay for the effect of NID1 on the nuclear location of β-Catenin in LCA cells. (D) IF assay for the effect of NID1 on the nuclear location of β-Catenin in LCA cells. (E) The effect of NID1 on the expression of the downstream genes of WNT pathway. Data represents the mean ± SD, **p < 0.01</p> <p>To confirm NID1 promotes LCA radiotherapy resistance and the self-renewal of LCA stem cells via activating WNT pathway. We knocked down TCF4 and LEF1 in NID1 overexpressing LCA cells (Supplementary Fig. 1F). Colony formation and apoptosis assays showed that TCF4 or LEF1 knockdown inhibited radiotherapy resistance caused by NID1 overexpression (Fig. 7A and B). Sphere formation assay showed that TCF4 or LEF1 knockdown inhibited sphere formation ability caused by NID1 overexpression (Fig. 7C). In addition, we determined the correlation between the levels of NID1 and nuclear β-Catenin in LCA tissues and revealed that NID1 level was positively correlated with nuclear β-Catenin level, confirming NID1 promotes WNT pathway (Fig. 7D). Taken together, these findings demonstrate that NID1 promotes radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway.</p> <p>Graph: Fig. 7 NID1 promotes LCA radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway. (A) Colony formation assay for the effect of inhibition of WNT pathway on radiotherapy resistance in NID1-overexpressing LCA cells. (B) Apoptosis assay for the effect of inhibition of WNT pathway on radiotherapy resistance in NID1-overexpressing LCA cells. (C) Sphere formation assay for the effect of inhibition of WNT pathway on radiotherapy resistance in NID1-overexpressing LCA cells. (D) The correlation between NID1 expression of nuclear β-Catenin in LCA tissues determined by WB assay. Data represents the mean ± SD, **p < 0.01</p> <hd id="AN0180904677-22">Discussion</hd> <p>In the present study, we aimed to study the effect of NID1 on LCA radiotherapy resistance and the self-renew of LCA stem cells. We showed that NID1 was significantly upregulated in LCA tissues, particularly in LCA tissues derived from relapsed patients. LCA patients with high NID level had poor outcome. NID1 promoted radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway. Moreover, NID1 level was positively correlated with nuclear β-Catenin level in LCA tissues.</p> <p>NID1 is a key secreted basement membrane protein and involved in many disease development, such as human cytomegalovirus infection [[<reflink idref="bib12" id="ref10">12</reflink>]], Hirschsprung's disease [[<reflink idref="bib13" id="ref11">13</reflink>]], diabetic kidney disease [[<reflink idref="bib14" id="ref12">14</reflink>]]. NID1 has been reported to regulate tumor growth and metastasis of various kinds of tumors via multiple mechanisms, for example, secreting NID1 induces EMT of colorectal cancer via a p53/miR-192/215/NID axis [[<reflink idref="bib15" id="ref13">15</reflink>]]. The role of NID1 in LCA hasn't been reported. Radiotherapy is a standard treatment method for most tumor therapy, including LCA. However, radiotherapy resistance is the main challenge for LCA therapy. Understanding its regulatory mechanisms is critical to predict and overcome radiotherapy resistance [[<reflink idref="bib16" id="ref14">16</reflink>]]. Thus, we studied the role of NID1 in LCA radiotherapy resistance. We found that NID1 promoted LCA radiotherapy resistance via cell viability assay, apoptosis assay and animal models. Furthermore, we investigated the role of NIN1 in the self-renew of LCA stem cells, which is a main reason for radiotherapy resistance generation. We found that NID1 promoted the self-renew of LCA stem cells via side population assay and sphere formation assay. Taken together, our results demonstrate that NID1 promotes LCA radiotherapy resistance and the self-renew of LCA stem cells, providing a novel potential target for LCA therapy.</p> <p>WNT pathway activation has been demonstrated as a critical driver in tumor initiation and progression [[<reflink idref="bib17" id="ref15">17</reflink>]]. WNT pathway could be activated in LCA by some factors, such as LncRNA UCA1 [[<reflink idref="bib19" id="ref16">19</reflink>]], and PRMT5/Wnt4 axis [[<reflink idref="bib20" id="ref17">20</reflink>]]. We found that NID1 could activate WNT pathway via determining the nuclear β-Catenin level and the expression of the targets of WNT pathway. Furthermore, inhibition of WNT pathway could reverse the effect of NID1 overexpression on LCA radiotherapy resistance and the self-renew of LCA stem cells. Thus, our study demonstrates that NID1 is a WNT pathway activator. NID1 promotes LCA radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway.</p> <p>In summary, we NID1 serves as an oncogene in LCA by promoting radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway. Inhibition of WNT pathway blocks the role of NID1 in radiotherapy resistance and the self-renew of LCA stem cells. Our results provide a potential target for LCA treatment.</p> <hd id="AN0180904677-23">Acknowledgements</hd> <p>Not applicable.</p> <hd id="AN0180904677-24">Author contributions</hd> <p>ZML, CFC and WLL designed all experiments, supervised the project.ZML wrote the manuscript.WLL, JW and YPL performed all the in vitro experiments. SYZ collected the specimens. YXL performed in vivo experiments and conducted IHC assay. WLL and AKY analysis and interpretation of data.All authors read and approved the final manuscript.</p> <hd id="AN0180904677-25">Funding</hd> <p>This work was supported by the Initial Funding of the National Natural Science Foundation of China in 2020 (Surface Project) (No. 8207100247); Initial Funding of the National Natural Science Foundation of China in 2021 (Major Research Project) (No. 9215910127) and Science and Technology Program of Guangzhou City, China (No.202002020024). </p> <hd id="AN0180904677-26">Data availability</hd> <p>No datasets were generated or analysed during the current study.</p> <hd id="AN0180904677-27">Declarations</hd> <p></p> <hd id="AN0180904677-28">Ethical approval</hd> <p>All experimental procedures in studies involving animals were in accordance with the ethical standards of the Institutions at which the studies were conducted and were approved by Institutional Animal Care and Use Committee of Guangdong Provincial People's Hospital.Prior patient consent and approval from the Institutional Research Ethics Committee of Guangdong Provincial People's Hospital were obtained for the use of these clinical materials for research purposes.</p> <hd id="AN0180904677-29">Consent for publication</hd> <p>Not applicable.</p> <hd id="AN0180904677-30">Competing interests</hd> <p>The authors declare no competing interests.</p> <hd id="AN0180904677-31">Electronic supplementary material</hd> <p>Below is the link to the electronic supplementary material.</p> <p>Graph: Supplementary Material 1</p> <hd id="AN0180904677-32">Publisher's note</hd> <p>Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.</p> <ref id="AN0180904677-33"> <title> References </title> <blist> <bibl id="bib1" idref="ref1" type="bt">1</bibl> <bibtext> Igissin N, Zatonskikh V, Telmanova Z, Tulebaev R, Moore M, Laryngeal Cancer. Epidemiology, etiology, and Prevention: a narrative review. Iran J Public Health. 2023; 52; 11: 2248-59. 10.18502/ijph.v52i11.14025. 38106821. 10719707</bibtext> </blist> <blist> <bibl id="bib2" type="bt">2</bibl> <bibtext> Xu J, Yang Y, Zhong Q, Hou L, Ma H, Zhang Y. A study of Peripheral Blood parameters to predict response to Induction Chemotherapy and overall survival in Advanced Laryngeal squamous cell carcinoma. Curr Oncol. 2022; 29; 9: 6472-84. 10.3390/curroncol29090509. 36135078. 9497498</bibtext> </blist> <blist> <bibl id="bib3" idref="ref2" type="bt">3</bibl> <bibtext> Loh JJ, Ma S. Hallmarks of cancer stemness. Cell Stem Cell. 2024; 31; 5: 617-39. 1:CAS:528:DC%2BB2cXps12gu7w%3D. 10.1016/j.stem.2024.04.004. 38701757</bibtext> </blist> <blist> <bibl id="bib4" idref="ref3" type="bt">4</bibl> <bibtext> Greco A, Rizzo MI, De Virgilio A, Gallo A, Fusconi M, Pagliuca G. Cancer stem cells in laryngeal cancer: what we know. Eur Arch Otorhinolaryngol. 2016; 273; 11: 3487-95. 1:STN:280:DC%2BC28vjtVCnsA%3D%3D. 10.1007/s00405-015-3837-9. 26585332</bibtext> </blist> <blist> <bibl id="bib5" idref="ref4" type="bt">5</bibl> <bibtext> Song M, Liu X, Li T, Zhang Y, Zhao X, Sun W. Silencing PLOD2 attenuates cancer stem cell-like characteristics and cisplatin-resistant through integrin beta1 in laryngeal cancer. Transl Oncol. 2022; 22: 101460. 1:CAS:528:DC%2BB38XitVeisLvM. 10.1016/j.tranon.2022.101460. 35660870. 9168686</bibtext> </blist> <blist> <bibl id="bib6" idref="ref5" type="bt">6</bibl> <bibtext> Chen H, Zhou L, Dou T, Wan G, Tang H, Tian J. BMI1'S maintenance of the proliferative capacity of laryngeal cancer stem cells. Head Neck. 2011; 33; 8: 1115-25. 10.1002/hed.21576. 21755556</bibtext> </blist> <blist> <bibl id="bib7" idref="ref6" type="bt">7</bibl> <bibtext> Tang T, Shan G. DGCR5 promotes cancer stem cell-like properties of radioresistant laryngeal carcinoma cells by sponging miR-506 via wnt pathway. J Cell Physiol. 2019; 234; 10: 18423-31. 1:CAS:528:DC%2BC1MXnt1Crtb4%3D. 10.1002/jcp.28478. 30980388</bibtext> </blist> <blist> <bibl id="bib8" idref="ref7" type="bt">8</bibl> <bibtext> Mao X, Tey SK, Yeung CLS, Kwong EML, Fung YME, Chung CYS. Nidogen 1-Enriched extracellular vesicles facilitate extrahepatic metastasis of Liver Cancer by activating pulmonary fibroblasts to Secrete Tumor Necrosis Factor Receptor 1. Adv Sci (Weinh). 2020; 7; 21: 2002157. 1:CAS:528:DC%2BB3cXitlWht7zN. 10.1002/advs.202002157. 33173740</bibtext> </blist> <blist> <bibl id="bib9" type="bt">9</bibl> <bibtext> Aleckovic M, Wei Y, LeRoy G, Sidoli S, Liu DD, Garcia BA. Identification of Nidogen 1 as a lung metastasis protein through secretome analysis. Genes Dev. 2017; 31; 14: 1439-55. 1:CAS:528:DC%2BC2sXhsFelsbjI. 10.1101/gad.301937.117. 28827399. 5588926</bibtext> </blist> <blist> <bibtext> Rokavec M, Jaeckel S, Hermeking H. Nidogen-1/NID1 function and regulation during progression and metastasis of Colorectal Cancer. Cancers (Basel). 2023;15(22). https://doi.org/10.3390/cancers15225316.</bibtext> </blist> <blist> <bibtext> Fountzilas E, Kotoula V, Angouridakis N, Karasmanis I, Wirtz RM, Eleftheraki AG. Identification and validation of a multigene predictor of recurrence in primary laryngeal cancer. PLoS ONE. 2013; 8; 8: e70429. 1:CAS:528:DC%2BC3sXhtlams7zI. 10.1371/journal.pone.0070429. 23950933. 3739775</bibtext> </blist> <blist> <bibtext> Kuan MI, Caruso LB, Zavala AG, Rana P, O'Dowd JM, Tempera I. Human cytomegalovirus utilizes multiple viral proteins to regulate the Basement Membrane Protein Nidogen 1. J Virol. 2022; 96; 20: e0133622. 1:CAS:528:DC%2BB38XivV2ntrzF. 10.1128/jvi.01336-22. 36218358</bibtext> </blist> <blist> <bibtext> Zhu D, Xie H, Li H, Cai P, Zhu H, Xu C. Nidogen-1 is a common target of microRNAs MiR-192/215 in the pathogenesis of Hirschsprung's disease. J Neurochem. 2015; 134; 1: 39-46. 1:CAS:528:DC%2BC2MXnsFyjtbk%3D. 10.1111/jnc.13118. 25857602</bibtext> </blist> <blist> <bibtext> Khattab A, Torkamani A. Nidogen-1 could play a role in diabetic kidney disease development in type 2 diabetes: a genome-wide association meta-analysis. Hum Genomics. 2022; 16; 1: 47. 1:CAS:528:DC%2BB38XislantrfK. 10.1186/s40246-022-00422-y. 36271454. 9587571</bibtext> </blist> <blist> <bibtext> Rokavec M, Bouznad N, Hermeking H. Paracrine induction of epithelial-mesenchymal transition between Colorectal Cancer cells and its suppression by a p53/miR-192/215/NID1 Axis. Cell Mol Gastroenterol Hepatol. 2019; 7; 4: 783-802. 10.1016/j.jcmgh.2019.02.003. 30831320. 6468198</bibtext> </blist> <blist> <bibtext> Larionova I, Rakina M, Ivanyuk E, Trushchuk Y, Chernyshova A, Denisov E. Radiotherapy resistance: identifying universal biomarkers for various human cancers. J Cancer Res Clin Oncol. 2022; 148; 5: 1015-31. 1:CAS:528:DC%2BB38Xos1ajtLo%3D. 10.1007/s00432-022-03923-4. 35113235</bibtext> </blist> <blist> <bibtext> Nusse R, Clevers H. Wnt/beta-Catenin signaling, Disease, and emerging therapeutic modalities. Cell. 2017; 169; 6: 985-99. 1:CAS:528:DC%2BC2sXpt1agsro%3D. 10.1016/j.cell.2017.05.016. 28575679</bibtext> </blist> <blist> <bibtext> Parsons MJ, Tammela T, Dow LE. WNT as a driver and dependency in Cancer. Cancer Discov. 2021; 11; 10: 2413-29. 1:CAS:528:DC%2BB3MXis1ynt7zP. 10.1158/2159-8290.CD-21-0190. 34518209. 8487948</bibtext> </blist> <blist> <bibtext> Sun S, Gong C, Yuan K. LncRNA UCA1 promotes cell proliferation, invasion and migration of laryngeal squamous cell carcinoma cells by activating Wnt/beta-catenin signaling pathway. Exp Ther Med. 2019; 17; 2: 1182-9. 1:CAS:528:DC%2BC1MXhtVKksbzJ. 10.3892/etm.2018.7097. 30679991</bibtext> </blist> <blist> <bibtext> Wang N, Yan H, Wu D, Zhao Z, Chen X, Long Q. PRMT5/Wnt4 axis promotes lymph-node metastasis and proliferation of laryngeal carcinoma. Cell Death Dis. 2020; 11; 10: 864. 1:CAS:528:DC%2BB3cXitV2rt7fK. 10.1038/s41419-020-03064-x. 33060569. 7566595</bibtext> </blist> </ref> <aug> <p>By Wenlin Liu; Jie Wu; Yuanpu Lai; Siyi Zhang; Ankui Yang; Yixuan Li; Cuifang Chen and Zhongming Lu</p> <p>Reported by Author; Author; Author; Author; Author; Author; Author; Author</p> </aug> <nolink nlid="nl1" bibid="bib10" firstref="ref8"></nolink> <nolink nlid="nl2" bibid="bib11" firstref="ref9"></nolink> <nolink nlid="nl3" bibid="bib12" firstref="ref10"></nolink> <nolink nlid="nl4" bibid="bib13" firstref="ref11"></nolink> <nolink nlid="nl5" bibid="bib14" firstref="ref12"></nolink> <nolink nlid="nl6" bibid="bib15" firstref="ref13"></nolink> <nolink nlid="nl7" bibid="bib16" firstref="ref14"></nolink> <nolink nlid="nl8" bibid="bib17" firstref="ref15"></nolink> <nolink nlid="nl9" bibid="bib19" firstref="ref16"></nolink> <nolink nlid="nl10" bibid="bib20" firstref="ref17"></nolink>
CustomLinks:
  – Url: https://resolver.ebsco.com/c/xy5jbn/result?sid=EBSCO:edsdoj&genre=article&issn=17456150&ISBN=&volume=19&issue=1&date=20241101&spage=1&pages=1-11&title=Biology Direct&atitle=NID1%20promotes%20laryngeal%20cancer%20stemness%20via%20activating%20WNT%20pathway&aulast=Wenlin%20Liu&id=DOI:10.1186/s13062-024-00548-0
    Name: Full Text Finder (for New FTF UI) (s8985755)
    Category: fullText
    Text: Find It @ SCU Libraries
    MouseOverText: Find It @ SCU Libraries
  – Url: https://doaj.org/article/0f505637185844af98c4023ce0b8991d
    Name: EDS - DOAJ (s8985755)
    Category: fullText
    Text: View record from DOAJ
    MouseOverText: View record from DOAJ
Header DbId: edsdoj
DbLabel: Directory of Open Access Journals
An: edsdoj.0f505637185844af98c4023ce0b8991d
RelevancyScore: 1063
AccessLevel: 3
PubType: Academic Journal
PubTypeId: academicJournal
PreciseRelevancyScore: 1063.02990722656
IllustrationInfo
Items – Name: Title
  Label: Title
  Group: Ti
  Data: NID1 promotes laryngeal cancer stemness via activating WNT pathway
– Name: Author
  Label: Authors
  Group: Au
  Data: <searchLink fieldCode="AR" term="%22Wenlin+Liu%22">Wenlin Liu</searchLink><br /><searchLink fieldCode="AR" term="%22Jie+Wu%22">Jie Wu</searchLink><br /><searchLink fieldCode="AR" term="%22Yuanpu+Lai%22">Yuanpu Lai</searchLink><br /><searchLink fieldCode="AR" term="%22Siyi+Zhang%22">Siyi Zhang</searchLink><br /><searchLink fieldCode="AR" term="%22Ankui+Yang%22">Ankui Yang</searchLink><br /><searchLink fieldCode="AR" term="%22Yixuan+Li%22">Yixuan Li</searchLink><br /><searchLink fieldCode="AR" term="%22Cuifang+Chen%22">Cuifang Chen</searchLink><br /><searchLink fieldCode="AR" term="%22Zhongming+Lu%22">Zhongming Lu</searchLink>
– Name: TitleSource
  Label: Source
  Group: Src
  Data: Biology Direct, Vol 19, Iss 1, Pp 1-11 (2024)
– Name: Publisher
  Label: Publisher Information
  Group: PubInfo
  Data: BMC, 2024.
– Name: DatePubCY
  Label: Publication Year
  Group: Date
  Data: 2024
– Name: Subset
  Label: Collection
  Group: HoldingsInfo
  Data: LCC:Biology (General)
– Name: Subject
  Label: Subject Terms
  Group: Su
  Data: <searchLink fieldCode="DE" term="%22NID1%22">NID1</searchLink><br /><searchLink fieldCode="DE" term="%22Laryngeal+cancer%22">Laryngeal cancer</searchLink><br /><searchLink fieldCode="DE" term="%22Radiotherapy+resistance%22">Radiotherapy resistance</searchLink><br /><searchLink fieldCode="DE" term="%22WNT+pathway%22">WNT pathway</searchLink><br /><searchLink fieldCode="DE" term="%22Cancer+stem+cells%22">Cancer stem cells</searchLink><br /><searchLink fieldCode="DE" term="%22Biology+%28General%29%22">Biology (General)</searchLink><br /><searchLink fieldCode="DE" term="%22QH301-705%2E5%22">QH301-705.5</searchLink>
– Name: Abstract
  Label: Description
  Group: Ab
  Data: Abstract Background Laryngeal cancer (LCA) is one of the most common head and neck squamous cell carcinoma with poor outcome. LCA stem cells are the main reason for LCA therapy resistance and relapse. Understanding the molecular mechanisms of the self-renew of LCA stem cells is critical to develop now targets and strategies for LCA therapy. Methods Q-PCR and western blotting assays were used to determine NID1 level in LCA tissues and normal laryngeal tissues. MTT, colony formation assay, apoptosis assay and animal model were used to investigate the effect of NID1 on radiotherapy resistance. Side population assay and sphere formation assay were used to determine the role of LCA in the self-renew of LCA stem cells. Results NID1 was upregulated in LCA tissues, particularly in LCA tissues derived from relapsed patients, and associated with had poor outcome. NID1 knockdown suppressed radiotherapy resistance and the self-renew of LCA stem cells, while NID1 overexpression promoted radiotherapy resistance and the self-renew of LCA stem cells. Further analysis showed that NID1 promotes radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway. Moreover, NID1 level was positively correlated with nuclear β-Catenin level in LCA tissues. Conclusion Our results show that NID1 promotes radiotherapy resistance and the self-renew of LCA stem cells via activating WNT pathway, providing a novel potential target for LCA treatment.
– Name: TypeDocument
  Label: Document Type
  Group: TypDoc
  Data: article
– Name: Format
  Label: File Description
  Group: SrcInfo
  Data: electronic resource
– Name: Language
  Label: Language
  Group: Lang
  Data: English
– Name: ISSN
  Label: ISSN
  Group: ISSN
  Data: 1745-6150<br />50563718
– Name: NoteTitleSource
  Label: Relation
  Group: SrcInfo
  Data: https://doaj.org/toc/1745-6150
– Name: DOI
  Label: DOI
  Group: ID
  Data: 10.1186/s13062-024-00548-0
– Name: URL
  Label: Access URL
  Group: URL
  Data: <link linkTarget="URL" linkTerm="https://doaj.org/article/0f505637185844af98c4023ce0b8991d" linkWindow="_blank">https://doaj.org/article/0f505637185844af98c4023ce0b8991d</link>
– Name: AN
  Label: Accession Number
  Group: ID
  Data: edsdoj.0f505637185844af98c4023ce0b8991d
PLink https://login.libproxy.scu.edu/login?url=https://search.ebscohost.com/login.aspx?direct=true&site=eds-live&scope=site&db=edsdoj&AN=edsdoj.0f505637185844af98c4023ce0b8991d
RecordInfo BibRecord:
  BibEntity:
    Identifiers:
      – Type: doi
        Value: 10.1186/s13062-024-00548-0
    Languages:
      – Text: English
    PhysicalDescription:
      Pagination:
        PageCount: 11
        StartPage: 1
    Subjects:
      – SubjectFull: NID1
        Type: general
      – SubjectFull: Laryngeal cancer
        Type: general
      – SubjectFull: Radiotherapy resistance
        Type: general
      – SubjectFull: WNT pathway
        Type: general
      – SubjectFull: Cancer stem cells
        Type: general
      – SubjectFull: Biology (General)
        Type: general
      – SubjectFull: QH301-705.5
        Type: general
    Titles:
      – TitleFull: NID1 promotes laryngeal cancer stemness via activating WNT pathway
        Type: main
  BibRelationships:
    HasContributorRelationships:
      – PersonEntity:
          Name:
            NameFull: Wenlin Liu
      – PersonEntity:
          Name:
            NameFull: Jie Wu
      – PersonEntity:
          Name:
            NameFull: Yuanpu Lai
      – PersonEntity:
          Name:
            NameFull: Siyi Zhang
      – PersonEntity:
          Name:
            NameFull: Ankui Yang
      – PersonEntity:
          Name:
            NameFull: Yixuan Li
      – PersonEntity:
          Name:
            NameFull: Cuifang Chen
      – PersonEntity:
          Name:
            NameFull: Zhongming Lu
    IsPartOfRelationships:
      – BibEntity:
          Dates:
            – D: 01
              M: 11
              Type: published
              Y: 2024
          Identifiers:
            – Type: issn-print
              Value: 17456150
            – Type: issn-print
              Value: 50563718
          Numbering:
            – Type: volume
              Value: 19
            – Type: issue
              Value: 1
          Titles:
            – TitleFull: Biology Direct
              Type: main
ResultId 1